Want to promote your business?
Home
About Us
Contact Us
Sign In / Sign Up!
MENU
Home
Blog
Tutorials
Questions
Interview Q&A
Previous Years Papers
Our Sponsors
About Us
Contact Us
NCERT
The Total solution for NCERT class 6-12
NCERT Class 6
NCERT Class 6 Maths
Chapter 1- Knowing Our Numbers
Chapter 1- Knowing Our Numbers Ex-1.1
Chapter 1- Knowing Our Numbers Ex-1.2
Chapter 1- Knowing Our Numbers Ex-1.3
Chapter 2 Whole Numbers
Chapter 2 Whole Numbers Ex-2.1
Chapter 2 Whole Numbers Ex-2.2
Chapter 2 Whole Numbers Ex-2.3
Chapter 3 Playing With Numbers
Chapter 3 Playing With Numbers Ex-3.1
Chapter 3 Playing With Numbers Ex-3.2
Chapter 3 Playing With Numbers Ex-3.3
Chapter 3 Playing With Numbers Ex-3.4
Chapter 3 Playing With Numbers Ex-3.5
Chapter 3 Playing With Numbers Ex-3.6
Chapter 3 Playing With Numbers Ex-3.7
Chapter 4 Basic Geometrical Ideas
Chapter 4 Basic Geometrical Ideas Ex-4.1
Chapter 4 Basic Geometrical Ideas Ex-4.2
Chapter 4 Basic Geometrical Ideas Ex-4.3
Chapter 4 Basic Geometrical Ideas Ex-4.4
Chapter 4 Basic Geometrical Ideas Ex-4.5
Chapter 4 Basic Geometrical Ideas Ex-4.6
Chapter 5 Understanding Elementary Shape
Chapter 5 Understanding Elementary Shape Ex-5.1
Chapter 5 Understanding Elementary Shape Ex-5.2
Chapter 5 Understanding Elementary Shape Ex-5.3
Chapter 5 Understanding Elementary Shape Ex-5.4
Chapter 5 Understanding Elementary Shape Ex-5.5
Chapter 5 Understanding Elementary Shape Ex-5.6
Chapter 5 Understanding Elementary Shape Ex-5.7
Chapter 5 Understanding Elementary Shape Ex-5.8
Chapter 5 Understanding Elementary Shape Ex-5.9
Chapter 6 Integers
Chapter 6 Integers Ex-6.1
Chapter 6 Integers Ex-6.2
Chapter 6 Integers Ex-6.3
Chapter 7 Fractions
Chapter 7 Fractions Ex-7.1
Chapter 7 Fractions Ex-7.2
Chapter 7 Fractions Ex-7.3
Chapter 7 Fractions Ex-7.4
Chapter 7 Fractions Ex-7.5
Chapter 7 Fractions Ex-7.6
Chapter 8 Decimals
Chapter 8 Decimals Ex-8.1
Chapter 8 Decimals Ex-8.2
Chapter 8 Decimals Ex-8.3
Chapter 8 Decimals Ex-8.4
Chapter 8 Decimals Ex-8.5
Chapter 8 Decimals Ex-8.6
Chapter 9 Data Handling
Chapter 9 Data Handling Ex-9.1
Chapter 9 Data Handling Ex-9.2
Chapter 9 Data Handling Ex-9.3
Chapter 9 Data Handling Ex-9.4
Chapter 10 Mensuration
Chapter 10 Mensuration Ex-10.1
Chapter 10 Mensuration Ex-10.2
Chapter 10 Mensuration Ex-10.3
Chapter 11 Algebra
Chapter 11 Algebra Ex-11.1
Chapter 11 Algebra Ex-11.2
Chapter 11 Algebra Ex-11.3
Chapter 11 Algebra Ex-11.4
Chapter 11 Algebra Ex-11.5
Chapter 12 Ratio and Proportion
Chapter 12 Ratio and Proportion Ex-12.1
Chapter 12 Ratio and Proportion Ex-12.2
Chapter 12 Ratio and Proportion Ex-12.3
Chapter 13 Symmetry
Chapter 13 Symmetry Ex-13.1
Chapter 13 Symmetry Ex-13.2
Chapter 13 Symmetry Ex-13.3
Chapter 14 Practical Geometry
Chapter 14 Practical Geometry Ex-14.1
Chapter 14 Practical Geometry Ex-14.2
Chapter 14 Practical Geometry Ex-14.3
Chapter 14 Practical Geometry Ex-14.4
Chapter 14 Practical Geometry Ex-14.5
Chapter 14 Practical Geometry Ex-14.6
NCERT Class 6 Science
Chapter 1- Food Where Does It Come From
Chapter 2 Components of Food
Chapter 3 Fibre to Fabric
Chapter 4 Sorting Materials Into Groups
Chapter 5 Separation of Substances
Chapter 6 Changes Around Us
Chapter 7 Getting to Know Plants
Chapter 8 Body Movements
Chapter 9 The Living Organisms and Their Surroundings
Chapter 10 Motion and Measurement of Distances
Chapter 11 Light Shadows and Reflection
Chapter 12 Electricity and Circuits
Chapter 13 Fun with Magnets
Chapter 14 Water
Chapter 15 Air Around Us
Chapter 16 Garbage In Garbage Out
NCERT Class 6 Social Science
NCERT Class 6 Social Science Geography
Chapter 1 The Earth in the Solar System
Chapter 2 Globe Latitudes and Longitudes
Chapter 3 Motions of the Earth
Chapter 4 Maps
Chapter 5 Major Domains of the Earth
Chapter 6 Major Landforms of the Earth
Chapter 7 Our Country India
Chapter 8 India Climate Vegetation and Wildlife
NCERT Class 6 Social Science History
Chapter 1 What Where How and When
Chapter 2 On The Trial of the Earliest People
Chapter 3 From Gathering to Growing Food
Chapter 4 In the Earliest Cities
Chapter 5 What Books and Burials Tell Us
Chapter 6 Kingdoms, Kings and an Early Republic
Chapter 7 New Questions and Ideas
Chapter 8 Ashoka, The Emperor Who Gave Up War
Chapter 9 Vital Villages - Thriving Towns
Chapter 10 Traders - Kings and Pilgrims
Chapter 11 New Empires and Kingdoms
Chapter 12 Buildings - Paintings - and Books
NCERT Class 6 Social Science Civics
Chapter 1 Understanding Diversity
Chapter 2 Diversity and Discrimination
Chapter 3 What is Government
Chapter 4 Key Elements of a Democratic Government
Chapter 5 Panchayati raj
Chapter 6 Rural Administration
Chapter 7 Urban Administration
Chapter 8 Rural Livelihoods
Chapter 9 Urban Livelihoods
NCERT Class 6 English
NCERT Class 6 English Honeysuckle Prose
Chapter 1 Who Did Patrick’s Homework
Chapter 2 How the Dog Found Himself a New Master
Chapter 3 Taro Reward
Chapter 4 An Indian-American Woman in Space - Kalpana Chawla
Chapter 5 A Different Kind of School
Chapter 6 Who I Am
Chapter 7 Fair Play
Chapter 8 A Game of Chance
Chapter 9 Desert Animals
Chapter 10 The Banyan Tree
NCERT Class 6 English Honeysuckle Poem
Chapter 1- A House - A Home
Chapter 2 The Kite
Chapter 3 The Quarrel
Chapter 4 Beauty
Chapter 5 Where Do All the Teachers Go
Chapter 6 The Wonderful Words
Chapter 7 Vocation
Chapter 8 What If
NCERT Class 6 English Supplementary Reader A Pact with the Sun
Chapter 1- A Tale of Two Birds
Chapter 2 The Friendly Mongoose
Chapter 3 The Shepherd’s Treasure
Chapter 4 The Old-Clock Shop
Chapter 5 Tansen
Chapter 6 The Monkey and the Crocodile
Chapter 7 The Wonder Called Sleep
Chapter 8 A Pact with the Sun
Chapter 9 What Happened to the Reptiles
Chapter 10- A Strange Wrestling Match
NCERT Class 6 Hindi
NCERT Class 6 Hindi Vasant
Chapter 1 वह चिड़िया जो
Chapter 2 बचपन
Chapter 3 नादान दोस्त
Chapter 4 चाँद से थोड़ी-सी गप्पें
Chapter 5 अक्षरों का महत्व
Chapter 6 पार नज़र के
Chapter 7 साथी हाथ बढ़ाना
Chapter 8 ऐसे-ऐसे
Chapter 9 टिकट अलबम
Chapter 10 झाँसी की रानी
Chapter 11 जो देखकर भी नहीं देखते
Chapter 12 संसार पुस्तक है
Chapter 13 मैं सबसे छोटी होऊँ
Chapter 14 लोकगीत
Chapter 15 नौकर
Chapter 16 वन के मार्ग में
Chapter 17 साँस-साँस में बाँस
NCERT Class 6 Hindi Bal Ramkatha बाल रामकथा
NCERT Class 7
NCERT Class 7 Maths
Chapter 1- Integers
Chapter 1- Integers Ex-1.1
Chapter 1- Integers Ex-1.2
Chapter 1- Integers Ex-1.3
Chapter 1- Integers Ex-1.4
Chapter 2 Fractions and Decimals
Chapter 2 Fractions and Decimals Ex-2.1
Chapter 2 Fractions and Decimals Ex-2.2
Chapter 2 Fractions and Decimals Ex-2.3
Chapter 2 Fractions and Decimals Ex-2.4
Chapter 2 Fractions and Decimals Ex-2.5
Chapter 2 Fractions and Decimals Ex-2.6
Chapter 2 Fractions and Decimals Ex-2.7
Chapter 3 Data Handling
Chapter 3 Data Handling Ex-3.1
Chapter 3 Data Handling Ex-3.2
Chapter 3 Data Handling Ex-3.3
Chapter 3 Data Handling Ex-3.4
Chapter 4 Simple Equations
Chapter 4 Simple Equations Ex-4.1
Chapter 4 Simple Equations Ex-4.2
Chapter 4 Simple Equations Ex-4.3
Chapter 4 Simple Equations Ex-4.4
Chapter 5 Lines and Angles
Chapter 5 Lines and Angles Ex-5.1
Chapter 5 Lines and Angles Ex-5.2
Chapter 6 The Triangles and its Properties
Chapter 6 The Triangles and its Properties Ex-6.1
Chapter 6 The Triangles and its Properties Ex-6.2
Chapter 6 The Triangles and its Properties Ex-6.3
Chapter 6 The Triangles and its Properties Ex-6.4
Chapter 6 The Triangles and its Properties Ex-6.5
Chapter 7 Congruence of Triangles
Chapter 7 Congruence of Triangles Ex-7.1
Chapter 7 Congruence of Triangles Ex-7.2
Chapter 8 Comparing Quantities
Chapter 8 Comparing Quantities Ex-8.1
Chapter 8 Comparing Quantities Ex-8.2
Chapter 8 Comparing Quantities Ex-8.3
Chapter 9 Rational Numbers
Chapter 9 Rational Numbers Ex-9.1
Chapter 9 Rational Numbers Ex-9.2
Chapter 10 Practical Geometry
Chapter 10 Practical Geometry Ex-10.1
Chapter 10 Practical Geometry Ex-10.2
Chapter 10 Practical Geometry Ex-10.3
Chapter 10 Practical Geometry Ex-10.4
Chapter 10 Practical Geometry Ex-10.5
Chapter 11 Perimeter and Area
Chapter 11 Perimeter and Area Ex-11.1
Chapter 11 Perimeter and Area Ex-11.2
Chapter 11 Perimeter and Area Ex-11.3
Chapter 11 Perimeter and Area Ex-11.4
Chapter 12 Algebraic Expressions
Chapter 12 Algebraic Expressions Ex-12.1
Chapter 12 Algebraic Expressions Ex-12.2
Chapter 12 Algebraic Expressions Ex-12.3
Chapter 12 Algebraic Expressions Ex-12.4
Chapter 13 Exponents and Powers
Chapter 13 Exponents and Powers Ex-13.1
Chapter 13 Exponents and Powers Ex-13.2
Chapter 13 Exponents and Powers Ex-13.3
Chapter 14 Symmetry
Chapter 14 Symmetry Ex-14.1
Chapter 14 Symmetry Ex-14.2
Chapter 14 Symmetry Ex-14.3
Chapter 15 Visualising Solid Shapes
Chapter 15 Visualising Solid Shapes Ex-15.1
Chapter 15 Visualising Solid Shapes Ex-15.2
Chapter 15 Visualising Solid Shapes Ex-15.3
Chapter 15 Visualising Solid Shapes Ex-15.4
NCERT Class 7 Science
Chapter 1 Nutrition in Plants
Chapter 2 Nutrition in Animals
Chapter- 3 Fibre to Fabric
Chapter 4 Heat
Chapter 5 Acids - Bases and Salts
Chapter 6 Physical and Chemical Changes
Chapter 7 Weather - Climate and Adaptations of Animals to Climate
Chapter 8 Winds - Storms and Cyclones
Chapter 9 Soil
Chapter 10 Respiration in Organisms
Chapter 11 Transportation in Animals and Plants
Chapter 12 Reproduction in Plants
Chapter 13 Motion and Time
Chapter 14 Electric Current and Its Effects
Chapter 15 Light
Chapter 16 Water- A Precious Resource
Chapter 17 Forests- Our Lifeline
Chapter 18 Wastewater Story
NCERT Class 7 Social Science
NCERT Class 7 Social Science Geography - Our Environment
Chapter 1- Environment
Chapter 2 Inside Our Earth
Chapter 3 Our Changing Earth
Chapter 4 Air
Chapter 5 Water
Chapter 6 Natural Vegetation and Wild Life
Chapter 7 Human Environment–Settlement-Transport and Communication
Chapter 8 Human Environment Interactions
Chapter 9- Life in the Temperate-Grasslands
Chapter 10 Life in the Deserts
NCERT Class 7 Social Science History - Our Pasts – II
Chapter 1 Tracing Changes Through A Thousand Years
Chapter 2 New Kings and Kingdoms
Chapter 3 The Delhi Sultans
Chapter 4 The Mughal Empire
Chapter 5 Rulers and Buildings
Chapter 6 Towns-Traders and Craftsperson
Chapter 7 Tribes-Nomads and Settled Communities
Chapter 8 Devotional Paths to the Divine
Chapter 9 The Making of Regional Cultures
Chapter 10 Eighteenth-Century Political Formations
NCERT Class 7 Social Science Civics - Social and Political Life – II
Chapter 1 On Equality
Chapter 2 Role of the Government in Health
Chapter 3 How the State Government Works
Chapter 4 Growing Up as Boys and Girls
Chapter 5 Women Change The World
Chapter 6 Understanding Media
Chapter 7 Understanding Advertisingv
Chapter 8 Markets Around Us
Chapter 9 A Shirt in the
NCERT Class 7 English
NCERT Class 7 English – Honeycomb
Chapter 1- Three Questions
Chapter 2 – A Gift of Chappals
Chapter 3 – Gopal and the Hilsa Fish
Chapter 4 – The Ashes that Made Trees Bloom
Chapter 5 – Quality
Chapter 6 – Expert Detectives
Chapter 7 – The Invention of Vita-Wonk
Chapter 8 – Fire- Friend and Foe
Chapter 9 – A Bicycle in Good Repair
Chapter 10- The Story of Cricket
Chapter 11 – The Squirrel (Poem)
Chapter 12 – The Rebel (Poem)
Chapter 13 – The Shed (Poem)
Chapter 14 – Chivvy (Poem)
Chapter 15 – Trees (Poem)
Chapter 16 – Mystery of the Talking Fan (Poem)
Chapter 17 – Dad and the Cat and the Tree (Poem)
Chapter 18 – Meadow Surprises (Poem)
Chapter 19 – Garden Snake (Poem)
NCERT Class 7 English – An Alien Hand
Chapter 1- The Tiny Teacher
Chapter 2 – Bringing Up Kari
Chapter 3 – The Desert
Chapter 4 – The Cop and the Anthem
Chapter 5 – Golu Grows a Nose
Chapter 6 – I Want Something in a Cage
Chapter 7 – Chandni
Chapter 8 – The Bear Story
Chapter 9 – A Tiger in the House
Chapter 10- An Alien Hand
NCERT Class 7 Hindi
NCERT Class 7 Hindi- वसंत, भाग – 2
Chapter 1 हम पंछी उन्मुक्त गगन के
Chapter 2 दादी माँ
Chapter 3 हिमालय की बेटियां
Chapter 4 कठपुतली
Chapter 5 मीठाईवाला
Chapter 6 रक्त और हमारा शरीर
Chapter 7 पापा खो गए
Chapter 8 शाम एक किशान
Chapter 9 चिड़िया की बच्ची
Chapter 10 अपूर्व अनुभव
Chapter 11 रहीम की दोहे
Chapter 12 कंचा
Chapter 13 एक तिनका
Chapter 14 खानपान की बदलती तस्वीर
Chapter 15 नीलकंठ
Chapter 16 भोर और बरखा
Chapter 17 वीर कुवर सिंह
Chapter 18 संघर्ष के कराण मैं तुनुकमिजाज हो गया धनराज
Chapter 19 आश्रम का अनुमानित व्यय
Chapter 20 विप्लव गायन
NCERT Class 7 Hindi Bal Mahabharat बाल महाभारत
NCERT Class 8
NCERT Class 8 Maths
Chapter 1 Rational Numbers
Chapter 1 Rational Numbers Ex 1.1
Chapter 1 Rational Numbers Ex 1.2
Chapter 2 Linear Equations in One Variable
Chapter 2 Linear Equations in One Variable Ex 2.1
Chapter 2 Linear Equations in One Variable Ex 2.2
Chapter 2 Linear Equations in One Variable Ex 2.3
Chapter 2 Linear Equations in One Variable Ex 2.4
Chapter 2 Linear Equations in One Variable Ex 2.5
Chapter 2 Linear Equations in One Variable Ex 2.6
Chapter 3 Understanding Quadrilaterals
Chapter 3 Understanding Quadrilaterals Ex 3.1
Chapter 3 Understanding Quadrilaterals Ex 3.2
Chapter 3 Understanding Quadrilaterals Ex 3.3
Chapter 3 Understanding Quadrilaterals Ex 3.4
Chapter 4 Practical Geometry
Chapter 4 Practical Geometry Ex 4.1
Chapter 4 Practical Geometry Ex 4.3
Chapter 4 Practical Geometry Ex 4.4
Chapter 4 Practical Geometry Ex 4.5
Chapter 4 Practical Geometry Ex 4.2
Chapter 5 Data Handling
Chapter 5 Data Handling Ex 5.1
Chapter 5 Data Handling Ex 5.2
Chapter 5 Data Handling Ex 5.3
Chapter 6 Squares and Square Roots
Chapter 6 Squares and Square Roots Ex 6.1
Chapter 6 Squares and Square Roots Ex 6.2
Chapter 6 Squares and Square Roots Ex 6.3
Chapter 6 Squares and Square Roots Ex 6.4
Chapter 7 Cubes and Cube Roots
Chapter 7 Cubes and Cube Roots Ex 7.1
Chapter 7 Cubes and Cube Roots Ex 7.2
Chapter- 8 Comparing Quantities
Chapter 8 Comparing Quantities Ex 8.1
Chapter 8 Comparing Quantities Ex 8.2
Chapter 8 Comparing Quantities Ex 8.3
Chapter 9 Algebraic Expressions and Identities
Chapter 9 Algebraic Expressions and Identities Ex 9.1
Chapter 9 Algebraic Expressions and Identities Ex 9.2
Chapter 9 Algebraic Expressions and Identities Ex 9.3
Chapter 9 Algebraic Expressions and Identities Ex 9.4
Chapter 9 Algebraic Expressions and Identities Ex 9.5
Chapter 10 Visualising Solid Shapes
Chapter 10 Visualising Solid Shapes Ex 10.1
Chapter 10 Visualising Solid Shapes Ex 10.2
Chapter 10 Visualising Solid Shapes Ex 10.3
Chapter 11 Mensuration
Chapter 11 Mensuration Ex 11.1
Chapter 11 Mensuration Ex 11.2
Chapter 11 Mensuration Ex 11.3
Chapter 11 Mensuration Ex 11.4
Chapter 12 Exponents and Powers
Chapter 12 Exponents and Powers Ex 12.1
Chapter 12 Exponents and Powers Ex 12.2
Chapter 13 Direct and Indirect proportions
Chapter 13 Direct and Indirect Proportions Ex 13.1
Chapter 13 Direct and Indirect Proportions Ex 13.2
Chapter 14 Factorisation
Chapter 14 Factorisation Ex 14.1
Chapter 14 Factorisation Ex 14.2
Chapter 14 Factorisation Ex 14.3
Chapter 15 Introduction to Graphs
Chapter 15 Introduction to Graphs Ex 15.1
Chapter 15 Introduction to Graphs Ex 15.2
Chapter 15 Introduction to Graphs Ex 15.3
Chapter 16 Playing with Numbers
Chapter 16 Playing with Numbers Ex 16.1
Chapter 16 Playing with Numbers Ex 16.2
NCERT Class 8 Science
Chapter 1- Crop Production and Management
Chapter 2 Microorganisms- Friend and Foe
Chapter 3 Synthetic Fibres and Plastics
Chapter 4 Materials- Metals and Non-Metals
Chapter- 3 Synthetic Fibres and Plastics
Chapter- 4 Materials- Metals and Non-Metals
Chapter 5 Coal and Petroleum
Chapter 6 Combustion and Flame
Chapter 7 Conservation of Plants and Animals
Chapter 8 Cell Structure and Functions
Chapter 9 Reproduction in Animals
Chapter 10 Reaching the Age of Adolescence
Chapter 11 Force and Pressure
Chapter 12 Friction
Chapter 13 Sound
Chapter 14 Chemical Effects of Electric Current
Chapter 15 Some Natural Phenomena
Chapter 16 Light
Chapter 17 Stars and the Solar System
Chapter 18 Pollution of Air and Water
NCERT Class 8 Social Science
NCERT Class 8 Social Science History- Our Pasts – III
Chapter 1 How - When and Where
Chapter 2 From Trade to Territory
Chapter 3 Ruling the Countryside
Chapter 4 Tribals - Dikus and the Vision of a Golden Age
Chapter 5 When People Rebel
Chapter 6 Colonialism and the City
Chapter 7 Weavers - Iron Smelters and Factory Owners
Chapter 8 Civilising the Native Educating the Nation
Chapter 9 Women-Caste and Reform
Chapter 10 The Changing World of Visual Arts
Chapter 11 The Making of the National Movement
Chapter 12 India After Independence
NCERT Class 8 Social Science Geography- Resources and Development
Chapter 1 Resources
Chapter 2 Land-Soil-Water-Natural Vegetation and Wildlife Resources
Chapter 3 Mineral and Power Resources
Chapter 4 Agriculture
Chapter 5 Industries
Chapter 6 Human Resource
NCERT Class 8 Social Science Civics- Social and Political Life – II
Chapter 1 The Indian Constitution
Chapter 2 Understanding Secularism
Chapter 3 Why Do We Need a Parliament
Chapter 4 Understanding Laws
Chapter 5 Judiciary
Chapter 6 Understanding Our Criminal Justice System
Chapter 7 Understanding Marginalisation
Chapter 8 Confronting Marginalisation
Chapter 9 Public Facilities
Chapter 10 Law and Social Justice
NCERT Class 8 English
NCERT Class 8 English – Honeydew
Chapter 1- The Best Christmas Present in the World
Chapter 2 – The Tsunami
Chapter 3 – Glimpses of the Past
Chapter 4 – Bepin Choudhury’s Lapse of Memory
Chapter 5 – The Summit Within
Chapter 6 – This is Jody’s Fawn
Chapter 7 – A Visit to Cambridge
Chapter 8 – A Short Monsoon Diary
Chapter 9 – The Great Stone Face – I
Chapter 10- The Great Stone Face – II
Chapter 11 – The Ant and the Cricket (Poem)
Chapter 12 – Geography Lesson (Poem)
Chapter 13 – Macavity – The Mystery Cat (Poem)
Chapter 14 – The Last Bargain (Poem)
Chapter 15 – The School Boy (Poem)
Chapter 16 – The Duck and the Kangaroo (Poem)
Chapter 17 – When I Set Out For Lyonnesse (Poem)
Chapter 18 – On the Grasshopper and Cricket (Poem)
NCERT Class 8 English – It So Happened
Chapter 1- How The Camel Got His Hump
Chapter 2 – Children at Work
Chapter 3 – The Selfish Giant
Chapter 4 – The Treasure Within
Chapter 5 – Princess September
Chapter 6 – The Fight
Chapter 7 – The Open Window
Chapter 8 – Jalebis
Chapter 9 – The Comet – I
Chapter 10- The Comet – II
NCERT Class 8 Hindi
NCERT Class 8 Hindi Vasant
Chapter 1 ध्वनि
Chapter 2 लाख की चूड़ियाँ
Chapter 3 बस की यात्रा
Chapter 4 दीवानों की हस्ती
Chapter 5 चिट्ठियों की अनूठी दुनिया
Chapter 6 भगवान के डाकिये
Chapter 7 क्या निराश हुआ जाए
Chapter 8 यह सबसे कठिन समय नहीं
Chapter 9 कबीर की साखियाँ
Chapter 10 कामचोर
Chapter 11 जब सिनेमा ने बोलना सीखा
Chapter 12 सुदामा चरित
Chapter 13 जहाँ पहिया हैं
Chapter 14 अकबरी लोटा
Chapter 15 सूरदास के पद
Chapter 16 पानी की कहानी
Chapter 17 बाज और साँप
Chapter 18 टोपी
NCERT Class 8 Hindi Bharat ki Khoj भारत की खोज
NCERT Class 9
NCERT Class 9 Science
Chapter 1 Matter in Our Surroundings
Chapter 2 Is Matter Around Us Pure
Chapter 3 Atoms And Molecules
Chapter 4 Structure Of The Atom
Chapter 5 The Fundamental Unit Of Life
Chapter 6 Tissues
Chapter 7 Diversity in Living Organisms
Chapter 8 Motion
Chapter 9 Force And Laws Of Motion
Chapter 10 Gravitation
Chapter 11 Work and Energy
Chapter 12 Sound
Chapter 13 Why Do We Fall ill
Chapter 14 Natural Resources
Chapter 15 Improvement in Food Resources
NCERT Class 9 Maths
Chapter 1 Number systems
Chapter 1 Number systems Ex- 1.1
Chapter 1 Number systems Ex- 1.2
Chapter 1 Number systems Ex- 1.3
Chapter 1 Number systems Ex- 1.4
Chapter 1 Number systems Ex- 1.5
Chapter 1 Number systems Ex- 1.6
Chapter 2 Polynomials
Chapter 2 Polynomials Ex-2.1
Chapter 2 Polynomials Ex-2.2
Chapter 2 Polynomials Ex-2.3
Chapter 2 Polynomials Ex-2.4
Chapter 2 Polynomials Ex-2.5
Chapter 3 Coordinate Geometry
Chapter 3 Coordinate Geometry Ex-3.1
Chapter 3 Coordinate Geometry Ex-3.2
Chapter 3 Coordinate Geometry Ex-3.3
Chapter 4 Linear Equations in Two Variables
Chapter 4 Linear Equations in Two Variables Ex-4.1
Chapter 4 Linear Equations in Two Variables Ex-4.2
Chapter 4 Linear Equations in Two Variables Ex-4.3
Chapter 4 Linear Equations in Two Variables Ex-4.4
Chapter 5 Introduction to Euclid Geometry
Chapter 5 Introduction to Euclid Geometry Ex-5.1
Chapter 5 Introduction to Euclid Geometry Ex-5.2
Chapter 6 Lines and Angles
Chapter 6 Lines and Angles Ex-6.1
Chapter 6 Lines and Angles Ex-6.2
Chapter 6 Lines and Angles Ex-6.3
Chapter 7 Triangles
Chapter 7 Triangles Ex-7.1
Chapter 7 Triangles Ex-7.2
Chapter 7 Triangles Ex-7.3
Chapter 7 Triangles Ex-7.4
Chapter 7 Triangles Ex-7.5
Chapter 8 Quadrilaterals
Chapter 8 Quadrilaterals Ex-8.1
Chapter 8 Quadrilaterals Ex-8.2
Chapter 9 Areas of Parallelograms and Triangles
Chapter 9 Areas of Parallelograms and Triangles Ex- 9.1
Chapter 9 Areas of Parallelograms and Triangles Ex- 9.2
Chapter 9 Areas of Parallelograms and Triangles Ex- 9.3
Chapter 9 Areas of Parallelograms and Triangles Ex- 9.4
Chapter 10 Circles
Chapter 10 Circles Ex-10.1
Chapter 10 Circles Ex-10.2
Chapter 10 Circles Ex-10.3
Chapter 10 Circles Ex-10.4
Chapter 10 Circles Ex-10.5
Chapter 10 Circles Ex-10.6
Chapter 11 Constructions
Chapter 11 Constructions Ex-11.1
Chapter 11 Constructions Ex-11.2
Chapter 12 Heron’s Formula
Chapter 12 Heron’s Formula Ex-12.1
Chapter 12 Heron’s Formula Ex-12.2
Chapter 13 Surface Areas and Volumes
Chapter 13 Surface Areas and Volumes Ex-13.1
Chapter 13 Surface Areas and Volumes Ex-13.2
Chapter 13 Surface Areas and Volumes Ex-13.3
Chapter 13 Surface Areas and Volumes Ex-13.4
Chapter 13 Surface Areas and Volumes Ex-13.5
Chapter 13 Surface Areas and Volumes Ex-13.6
Chapter 13 Surface Areas and Volumes Ex-13.7
Chapter 13 Surface Areas and Volumes Ex-13.8
Chapter 13 Surface Areas and Volumes Ex-13.9
Chapter 14 Statistics
Chapter 14 Statistics EX-14.1
Chapter 14 Statistics EX-14.2
Chapter 14 Statistics EX-14.3
Chapter 14 Statistics EX-14.4
Chapter 15 Probability
Chapter 15 Probability Ex-15.1
NCERT Class 9 Social Science
NCERT Class 9 Social Science - Contemporary India I
Chapter 1- India Size and Location
Chapter 2 – Physical Features of India
Chapter 3 – Drainage
Chapter 4 – Climate
Chapter 5 – Natural Vegetation and Wildlife
Chapter 6 – Population
NCERT Class 9 Social Science – Democratic Politics I
Chapter 1- Democracy in the Contemporary World
Chapter 2- What is Democracy-Why Democracy
Chapter 3 – Constitutional Design
Chapter 4 – Electoral Politics
Chapter 5 – Working of Institutions
Chapter 6 – Democratic Rights
NCERT Class 9 Social Science – Economics
Chapter 1- The Story of Village Palampu
Chapter 2 – People as Resource
Chapter 3 – Poverty as a Challenge
Chapter 4 – Food Security in India
NCERT Class 9 Social Science – India and the Contemporary World I
Chapter 1- The French Revolution
Chapter 2 – Socialism in Europe and the Russian Revolution
Chapter 3 – Nazism and the Rise of Hitler
Chapter 4 – Forest Society and Colonialism
Chapter 5 – Pastoralists in the Modern World
Chapter 6 – Peasants and Farmers
Chapter 7- History and Sport-The Story of Cricket
Chapter 8- Clothing-A Social History
NCERT Class 9 English
NCERT Class 9 English - Beehive
Chapter 1- The Fun They Had
Chapter 2 – The Road Not Taken (Poem)
Chapter 3 – The Sound of Music
Chapter 4 – Wind (Poem)
Chapter 5 – The Little Girl
Chapter 6 – Rain on the Roof (Poem)
Chapter 7 – A Truly Beautiful Mind
Chapter 8 – The Lake Isle of Innisfree (Poem)
Chapter 9 – The Snake and the Mirror
Chapter 10- A Legend of the Northland (Poem)
Chapter 11- My Childhood
Chapter 12 – No Men Are Foreign (Poem)
Chapter 13 – Packing
Chapter 14 – Reach for the Top
Chapter 15 – On Killing a Tree (Poem)
Chapter 16 – The Bond of Love
Chapter 17 – The Snake Trying (Poem)
Chapter 18 – Kathmandu
Chapter 19 – A Slumber Did My Spirit Seal (Poem)
Chapter 20 – If I Were You
NCERT Class 9 English - Moments
Chapter 1- The Lost Child
Chapter 2 – The Adventures of Toto
Chapter 3 – Iswaran the Storyteller
Chapter 4 – In the Kingdom of Fools
Chapter 5 – The Happy Prince
Chapter 6 – Weathering the Storm in Ersama
Chapter 7 – The Last Leaf
Chapter 8 – A House is Not a Home
Chapter 9 – The Accidental Tourist
Chapter 10- The Beggar
NCERT Class 9 Hindi
NCERT Class 9 Hindi Kshitij Bhag 1 क्षितिज भाग 1
Chapter 1 दो बैलों की कथा
Chapter 2 ल्हासा की ओर
Chapter 3 उपभोक्तावाद की संस्कृति
Chapter 4 साँवले सपनों की याद
Chapter 5 नाना साहब की पुत्री देवी मैना को भस्म कर दिया गया
Chapter 6 प्रेमचंद के फटे जूते
Chapter 7 मेरे बचपन के दिन
Chapter 8 एक कुत्ता और एक मैना
Chapter 9 साखियाँ एवं सबद
Chapter 10 वाख
Chapter 11 सवैये
Chapter 12 कैदी और कोकिला
Chapter 13 ग्राम श्री
Chapter 14 चंद्र गहना से लौटती बेर
Chapter 15 मेघ आए
Chapter 16 यमराज की दिशा
Chapter 17 बच्चे काम पर जा रहे हैं
NCERT Class 9 Hindi Kritika Bhag 1 कृतिका भाग 1
Chapter 1 इस जल प्रलय में
Chapter 2 मेरे संग की औरतें
Chapter 3 रीढ़ की हड्डी
Chapter 4 माटी वाली
Chapter 5 किस तरह आखिरकार मैं हिंदी में आया
NCERT Class 9 Hindi Sparsh Bhag 1 स्पर्श भाग 1
Chapter 1 धूल
Chapter 2 दुःख का अधिकार
Chapter 3 एवरेस्ट मेरी शिखर यात्रा
Chapter 4 तुम कब जाओगे अतिथि
Chapter 5 वैज्ञानिक चेतना के वाहक-चन्द्र शेखर वेंकट रामन
Chapter 6 कीचड़ का काव्य
Chapter 7 धर्म की आड़
Chapter 8 शक्र तारे के समान
Chapter 9 अब कैसे छूटे राम नाम-ऐसी लाल तुझ बिनु
Chapter 10 दोहे
Chapter 11 आदमी नामा
Chapter 12 एक फूल की चाह
Chapter 13 गीत-अगीत
Chapter 14 अग्नि पथ
Chapter 15 नए इलाके में-खुशबू रचते हैं हाथ
NCERT Class 9 Hindi Sanchayan Bhag 1 संचयन भाग 1
Chapter 1 गिल्लू
Chapter 2 स्मृति
Chapter 3 कल्लू कुम्हार की उनाकोटी
Chapter 4 मेरा छोटा-सा निजी पुस्तकालय
Chapter 5 हामिद खाँ
Chapter 6 दिये जल उठे
NCERT Class 9 Maths RD Sharma Solutions
RD Chapter 1- Number Systems
RD Chapter 1- Number Systems Ex-1.1
RD Chapter 1- Number Systems Ex-1.2
RD Chapter 1- Number Systems Ex-1.3
RD Chapter 1- Number Systems Ex-1.4
RD Chapter 1- Number Systems Ex-1.5
RD Chapter 1- Number Systems Ex-1.6
RD Chapter 2- Exponents of Real Numbers
RD Chapter 2- Exponents of Real Numbers Ex-2.1
RD Chapter 2- Exponents of Real Numbers Ex-2.2
RD Chapter 2- Exponents of Real Numbers Ex-VSAQS
RD Chapter 2- Exponents of Real Numbers Ex-MCQS
RD Chapter 3- Rationalisation
RD Chapter 3- Rationalisation Ex-3.1
RD Chapter 3- Rationalisation Ex-3.2
RD Chapter 3- Rationalisation Ex-VSAQS
RD Chapter 3- Rationalisation Ex-MCQS
RD Chapter 4- Algebraic Identities
RD Chapter 4- Algebraic Identities Ex-4.1
RD Chapter 4- Algebraic Identities Ex-4.2
RD Chapter 4- Algebraic Identities Ex-4.3
RD Chapter 4- Algebraic Identities Ex-4.4
RD Chapter 4- Algebraic Identities Ex-4.5
RD Chapter 4- Algebraic Identities Ex-VSAQS
RD Chapter 4- Algebraic Identities Ex-MCQS
RD Chapter 5- Factorisation of Algebraic Expressions
RD Chapter 5- Factorisation of Algebraic Expressions Ex-5.1
RD Chapter 5- Factorisation of Algebraic Expressions Ex-5.2
RD Chapter 5- Factorisation of Algebraic Expressions Ex-5.3
RD Chapter 5- Factorisation of Algebraic Expressions Ex-5.4
RD Chapter 5- Factorisation of Algebraic Expressions Ex-VSAQS
RD Chapter 5- Factorisation of Algebraic Expressions Ex-MCQS
RD Chapter 6- Factorisation of Polynomials
RD Chapter 6- Factorisation of Polynomials Ex-6.1
RD Chapter 6- Factorisation of Polynomials Ex-6.2
RD Chapter 6- Factorisation of Polynomials Ex-6.3
RD Chapter 6- Factorisation of Polynomials Ex-6.4
RD Chapter 6- Factorisation of Polynomials Ex-6.5
RD Chapter 6- Factorisation of Polynomials Ex-VSAQS
RD Chapter 6- Factorisation of Polynomials Ex-MCQS
RD Chapter 7- Introduction to Euclid-s Geometry
RD Chapter 7- Introduction to Euclid-s Geometry Ex-7.1
RD Chapter 7- Introduction to Euclid-s Geometry Ex-7.2
RD Chapter 7- Introduction to Euclid-s Geometry Ex-7.3
RD Chapter 7- Introduction to Euclid-s Geometry Ex-7.4
RD Chapter 7- Introduction to Euclid-s Geometry Ex-VSAQS
RD Chapter 7- Introduction to Euclid-s Geometry Ex-MCQS
RD Chapter 8- Lines and Angles
RD Chapter 8- Lines and Angles Ex-8.1
RD Chapter 8- Lines and Angles Ex-8.2
RD Chapter 8- Lines and Angles Ex-8.3
RD Chapter 8- Lines and Angles Ex-8.4
RD Chapter 8- Lines and Angles Ex-VSAQS
Rd Chapter 9- Triangle and its Angles
Rd Chapter 9- Triangle and its Angles Ex-9.1
Rd Chapter 9- Triangle and its Angles Ex-9.2
Rd Chapter 9- Triangle and its Angles Ex-VSAQS
RD Chapter 10- Congruent Triangles
RD Chapter 10- Congruent Triangles Ex-10.1
RD Chapter 10- Congruent Triangles Ex-10.2
RD Chapter 10- Congruent Triangles Ex-10.3
RD Chapter 10- Congruent Triangles Ex-10.4
RD Chapter 10- Congruent Triangles Ex-VSAQS
RD Chapter 10- Congruent Triangles Ex-MCQS
RD Chapter 11- Co-ordinate Geometry
RD Chapter 11- Co-ordinate Geometry Ex-11.1
RD Chapter 11- Co-ordinate Geometry Ex-11.2
RD Chapter 11- Co-ordinate Geometry Ex-VSAQS
RD Chapter 11- Co-ordinate Geometry Ex-MCQS
RD Chapter 12- Heron-s Formula
RD Chapter 12- Heron-s Formula Ex-12.1
RD Chapter 12- Heron-s Formula Ex-12.2
RD Chapter 12- Heron-s Formula Ex-12.3
RD Chapter 12- Heron-s Formula Ex-12.4
RD Chapter 12- Heron-s Formula Ex-12.5
RD Chapter 12- Heron-s Formula Ex-12.6
RD Chapter 12- Heron-s Formula Ex-VSAQS
RD Chapter 12- Heron-s Formula Ex-MCQS
RD Chapter 13- Linear Equations in Two Variables
RD Chapter 13- Linear Equations in Two Variables Ex-13.1
RD Chapter 13- Linear Equations in Two Variables Ex-13.2
RD Chapter 13- Linear Equations in Two Variables Ex-13.3
RD Chapter 13- Linear Equations in Two Variables Ex-13.4
RD Chapter 13- Linear Equations in Two Variables Ex-VSAQS
RD Chapter 14- Quadrilaterals
RD Chapter 14- Quadrilaterals Ex-14.1
RD Chapter 14- Quadrilaterals Ex-14.2
RD Chapter 14- Quadrilaterals Ex-14.3
RD Chapter 14- Quadrilaterals Ex-14.4
RD Chapter 14- Quadrilaterals Ex-VSAQS
RD Chapter 15- Areas of Parallelograms and Triangles
RD Chapter 15- Areas of Parallelograms and Triangles Ex-15.1
RD Chapter 15- Areas of Parallelograms and Triangles Ex-15.2
RD Chapter 15- Areas of Parallelograms and Triangles Ex-15.3
RD Chapter 15- Areas of Parallelograms and Triangles Ex-VSAQS
RD Chapter 16- Circles
RD Chapter 16- Circles Ex-16.1
RD Chapter 16- Circles Ex-16.2
RD Chapter 16- Circles Ex-16.3
RD Chapter 16- Circles Ex-16.4
RD Chapter 16- Circles Ex-16.5
RD Chapter 16- Circles Ex-VSAQS
RD Chapter 17- Constructions
RD Chapter 17- Constructions Ex-17.1
RD Chapter 17- Constructions Ex-17.2
RD Chapter 17- Constructions Ex-17.3
RD Chapter 18- Surface Areas and Volume of a Cuboid and Cube
RD Chapter 18- Surface Areas and Volume of a Cuboid and Cube Ex-18.1
RD Chapter 18- Surface Areas and Volume of a Cuboid and Cube Ex-18.2
RD Chapter 18- Surface Areas and Volume of a Cuboid and Cube Ex-VSAQS
RD Chapter 19- Surface Areas and Volume of a Circular Cylinder
RD Chapter 19- Surface Areas and Volume of a Circular Cylinder Ex-19.1
RD Chapter 19- Surface Areas and Volume of a Circular Cylinder Ex-19.2
RD Chapter 19- Surface Areas and Volume of a Circular Cylinder Ex-VSAQS
Chapter 20- Surface Areas and Volume of A Right Circular Cone
RD Chapter 20- Surface Areas and Volume of A Right Circular Cone Ex-20.1
RD Chapter 20- Surface Areas and Volume of A Right Circular Cone Ex-20.2
RD Chapter 20- Surface Areas and Volume of A Right Circular Cone Ex-VSAQS
RD Chapter 21- Surface Areas and Volume of a Sphere
RD Chapter 21- Surface Areas and Volume of a Sphere Ex-21.1
RD Chapter 21- Surface Areas and Volume of a Sphere Ex-21.2
RD Chapter 21- Surface Areas and Volume of a Sphere Ex-VSAQS
RD Chapter 22- Tabular Representation of Statistical Data
RD Chapter 22- Tabular Representation of Statistical Data Ex-22.1
RD Chapter 22- Tabular Representation of Statistical Data Ex-22.2
RD Chapter 22- Tabular Representation of Statistical Data Ex-MCQS
RD Chapter 23- Graphical Representation of Statistical Data
RD Chapter 23- Graphical Representation of Statistical Data Ex-23.1
RD Chapter 23- Graphical Representation of Statistical Data Ex-23.2
RD Chapter 23- Graphical Representation of Statistical Data Ex-23.3
RD Chapter 23- Graphical Representation of Statistical Data Ex-MCQS
RD Chapter 24- Measures of Central Tendency
RD Chapter 24- Measures of Central Tendency Ex-24.1
RD Chapter 24- Measures of Central Tendency Ex-24.2
RD Chapter 24- Measures of Central Tendency Ex-24.3
RD Chapter 24- Measures of Central Tendency Ex-24.4
RD Chapter 24- Measures of Central Tendency Ex-VSAQS
RD Chapter 25- Probability
RD Chapter 25- Probability Ex-25.1
RD Chapter 25- Probability Ex-VSAQS
NCERT Class 10
NCERT Class 10 - Science
Chapter 1- Chemical Reactions and Equations
Chapter 2– Acids Bases and Salt
Chapter 3– Metals and Non-Metals
Chapter 4- Carbon and its Compounds
Chapter 5- Periodic Classification of Elements
Chapter 6- Life Process
Chapter 7– Control and Coordination
Chapter 8- How do Organisms Reproduce
Chapter 9- Heredity and Evolution
Chapter 10- Light-Reflection and Refraction
Chapter 11- The Human Eye and Colourful World
Chapter 12 – Electricity
Chapter 13- Magnetic Effects of Electric Current
Chapter 14- Sources of Energy
Chapter 15 – Our Environment
Chapter 16 – Sustainable Management of Natural Resources
NCERT Class 10 - English - First Flight
Chapter 1- A Letter to God
Chapter 2- Nelson Mandela- Long Walk to Freedom
Chapter 3- Two Stories about Flying
Chapter 4- From the Diary of Anne Frank
Chapter 5- The Hundred Dresses–I
Chapter 6- The Hundred Dresses–II
Chapter 7- Glimpses of India
Chapter 8- Mijbil the Otter
Chapter 9- Madam Rides the Bus
Chapter 10- The Sermon at Benares
NCERT Class 10 - English - Footprints
Chapter 1- A Triumph of Surgery
Chapter 2- The Thiefs Story
Chapter 3- The Midnight Visitor
Chapter 4- A Question of Trust
Chapter 5- Footprints without Feet
Chapter 6- The Making of a Scientist
Chapter 7- The Necklace
Chapter 8- The Hack Driver
Chapter 9- Bholi
Chapter 10- The Book That Saved the Earth
NCERT Class 10 - SST -Democratic Politics II
Chapter 1- Power Sharing
Chapter 2- Federalism
Chapter 3- Democracy and Diversity
Chapter 4- Gender, Religion and Caste
Chapter 5- Popular Struggles and Movements
Chapter 6- Political Parties
Chapter 7- Outcomes of Democracy
Chapter 8- Challenges to Democracy
NCERT Class 10 - SST - Contemporary India II
Chapter 1- Resources and Development
Chapter 2- Forest and Wildlife Resources
Chapter 3- Water Resources
Chapter 4- Agriculture
Chapter 5- Minerals and Energy Resources
Chapter 6- Manufacturing Industries
Chapter 7- Lifelines of National Economy
NCERT Class 10 - SST - Economic
Chapter 1- Development
Chapter 2- Sectors of the Indian Economy
Chapter 3- Money and Credit
Chapter 4- Globalisation and the Indian Economy
Chapter 5- Consumer Rights
NCERT Class 10 - SST - India and Contemporary II
Chapter 1- The Rise of Nationalism in Europe
Chapter 2- Nationalism in India
Chapter 3- The Making of a Global World
Chapter 4- The Age of Industrialisation
Chapter 5- Print Culture and The Modern World
NCERT Class 10 - Maths
Chapter 1- Real Numbers
Real Numbers Ex-1.1
Real Numbers Ex-1.2
Real Numbers Ex-1.3
Real Numbers Ex-1.4
Chapter 2- Polynomials
Polynomials Ex-2.1
Polynomials Ex-2.2
Polynomials Ex-2.3
Polynomials Ex-2.4
Chapter 3- Pair of Linear Equations in Two Variabl
Pa.Linear Eq Ex-3.1
Pa.Linear Eq Ex-3.2
Pa.Linear Eq Ex-3.3
Pa.Linear Eq Ex-3.4
Pa.Linear Eq Ex-3.5
Pa.Linear Eq Ex-3.6
Pa.Linear Eq Ex-3.7
Chapter 4- Quadratic Equations
Quadratic Equations Ex-4.1
Quadratic Equations Ex-4.2
Quadratic Equations Ex-4.3
Quadratic Equations Ex-4.4
Chapter 5- Arithmetic Progressions
Arithmetic Progressions Ex-5.1
Arithmetic Progressions Ex-5.2
Arithmetic Progressions Ex-5.3
Arithmetic Progressions Ex-5.4
Chapter 6- Triangles
Triangles EX-6.1
Triangles EX-6.2
Triangles EX-6.3
Triangles EX-6.4
Triangles EX-6.5
Triangles EX-6.6
Chapter 7- Coordinate Geometry
Coordinate Geometry Ex-7.1
Coordinate Geometry Ex-7.2
Coordinate Geometry Ex-7.3
Coordinate Geometry Ex-7.4
Chapter 8- Introduction to Trigonometry
Introduction to Trigonometry Ex-8.1
Introduction to Trigonometry Ex-8.2
Introduction to Trigonometry Ex-8.3
Introduction to Trigonometry Ex-8.4
Chapter 9- Some Applications of Trigonometry
Applications of Trigonometry Ex-9.1
Chapter 10- Circles
Circles Ex-10.1
Circles Ex-10.2
Chapter 11- Constructions
Constructions Ex-11.1
Constructions Ex-11.2
Chapter 12- Areas Related to Circles
Areas Related to Circles Ex-12.1
Areas Related to Circles Ex-12.2
Areas Related to Circles Ex-12.3
Chapter 13- Surface Areas and Volumes
Surface Areas and Volumes Ex-13.1
Surface Areas and Volumes Ex-13.2
Surface Areas and Volumes Ex-13.3
Surface Areas and Volumes Ex-13.4
Surface Areas and Volumes Ex-13.5
Chapter 14- Statistics
Statistics Ex-14.1
Statistics Ex-14.2
Statistics Ex-14.3
Statistics Ex-14.4
Chapter 15- Probability
Probability Ex-15.1
Probability Ex-15.2
NCERT Class 10 - Hindi Kshitij क्षितिज भाग 2
Chapter 1- पद
Chapter 2- राम-लक्ष्मण-परशुराम संवाद
Chapter 3- सवैया और कवित्त
Chapter 4- आत्मकथ्य
Chapter 5- उत्साह और अट नहीं रही
Chapter 6- यह दंतुरहित मुस्कान और फसल
Chapter 7- छाया मत छूना
Chapter 8- कन्यादान
Chapter 9- संगतकार
Chapter 11- बालगोबिन भगत
Chapter 12- लखनवी अंदाज़
Chapter 13- मानवीय करुणा की दिव्या चमक
Chapter 14- एक कहानी यह भी
Chapter 15- स्त्री शिक्षा के विरोधी कुतर्कों का खंडन
Chapter 16- नौबतखाने में इबादत
Chapter 17- संस्कृति
Chapter 10 नेताजी का चश्मा
NCERT Class 10 - Hindi Sparsh Bhag 2 स्पर्श भाग 2
Chapter 1- साखी
Chapter 2- पद
Chapter 3- दोहे
Chapter 4- मनुष्यता
Chapter 5- पर्वत प्रदेश में पावस
Chapter 6- मधुर-मधुर मेरे दीपक जल
Chapter 7- तोप
Chapter 8- कर चले हम फ़िदा
Chapter 9- आत्मत्राण
Chapter 10- बड़े भाई साहब
Chapter 11- डायरी का एक पन्ना
Chapter 12- तताँरा-वामीरो कथा
Chapter 13- तीसरी कसम के शिल्पकार शैलेंद्र
Chapter 14- गिरगिट
Chapter 15- अब कहाँ दूसरे के दुख से दुखी होने वाले
Chapter 16- पतझर में टूटी पत्तियाँ
Chapter 17- कारतूस
NCERT Class 10 Maths RD Sharma Solutions
RD Chapter 1- Real Numbers
RD Chapter 1- Real Numbers Ex-1.1
RD Chapter 1- Real Numbers Ex-1.2
RD Chapter 1- Real Numbers Ex-1.3
RD Chapter 1- Real Numbers Ex-1.4
RD Chapter 1- Real Numbers Ex-1.5
RD Chapter 1- Real Numbers Ex-1.6
RD Chapter 1- Real Numbers Ex-VSAQS
RD Chapter 1- Real Numbers Ex-MCQS
RD Chapter 2- Polynomials
RD Chapter 2- Polynomials Ex-2.1
RD Chapter 2- Polynomials Ex-2.2
RD Chapter 2- Polynomials Ex-2.3
RD Chapter 2- Polynomials Ex-VSAQS
RD Chapter 2- Polynomials Ex-MCQS
RD Chapter 3- Pair of Linear Equations in Two Variables
RD Chapter 3- Pair of Linear Equations in Two Variables Ex-3.1
RD Chapter 3- Pair of Linear Equations in Two Variables Ex-3.2
RD Chapter 3- Pair of Linear Equations in Two Variables Ex-3.3
RD Chapter 3- Pair of Linear Equations in Two Variables Ex-3.4
RD Chapter 3- Pair of Linear Equations in Two Variables Ex-3.5
RD Chapter 3- Pair of Linear Equations in Two Variables Ex-3.6
RD Chapter 3- Pair of Linear Equations in Two Variables Ex-3.7
RD Chapter 3- Pair of Linear Equations in Two Variables Ex-3.8
RD Chapter 3- Pair of Linear Equations in Two Variables Ex-3.9
RD Chapter 3- Pair of Linear Equations in Two Variables Ex-3.10
RD Chapter 3- Pair of Linear Equations in Two Variables Ex-3.11
RD Chapter 3- Pair of Linear Equations in Two Variables Ex-VSAQS
RD Chapter 4- Triangles
RD Chapter 4- Triangles Ex-4.1
RD Chapter 4- Triangles Ex-4.2
RD Chapter 4- Triangles Ex-4.3
RD Chapter 4- Triangles Ex-4.4
RD Chapter 4- Triangles Ex-4.5
RD Chapter 4- Triangles Ex-4.6
RD Chapter 4- Triangles Ex-4.7
RD Chapter 5- Trigonometric Ratios
RD Chapter 5- Trigonometric Ratios Ex-5.1
RD Chapter 5- Trigonometric Ratios Ex-5.2
RD Chapter 5- Trigonometric Ratios Ex-5.3
RD Chapter 6- Trigonometric Identities
RD Chapter 6- Trigonometric Identities Ex-6.1
RD Chapter 6- Trigonometric Identities Ex-6.2
RD Chapter 7- Statistics
RD Chapter 7- Statistics Ex-7.1
RD Chapter 7- Statistics Ex-7.2
RD Chapter 7- Statistics Ex-7.3
RD Chapter 7- Statistics Ex-7.4
RD Chapter 7- Statistics Ex-7.5
RD Chapter 7- Statistics Ex-7.6
RD Chapter 8- Quadratic Equations
RD Chapter 8- Quadratic Equations Ex-8.1
RD Chapter 8- Quadratic Equations Ex-8.2
RD Chapter 8- Quadratic Equations Ex-8.3
RD Chapter 8- Quadratic Equations Ex-8.4
RD Chapter 8- Quadratic Equations Ex-8.5
RD Chapter 8- Quadratic Equations Ex-8.6
RD Chapter 8- Quadratic Equations Ex-8.7
RD Chapter 8- Quadratic Equations Ex-8.8
RD Chapter 8- Quadratic Equations Ex-8.9
RD Chapter 8- Quadratic Equations Ex-8.10
RD Chapter 8- Quadratic Equations Ex-8.11
RD Chapter 8- Quadratic Equations Ex-8.12
RD Chapter 8- Quadratic Equations Ex-8.13
Rd Chapter 9- Arithmetic Progressions
Rd Chapter 9- Arithmetic Progressions Ex-9.1
Rd Chapter 9- Arithmetic Progressions Ex-9.2
Rd Chapter 9- Arithmetic Progressions Ex-9.3
Rd Chapter 9- Arithmetic Progressions Ex-9.4
Rd Chapter 9- Arithmetic Progressions Ex-9.5
Rd Chapter 9- Arithmetic Progressions Ex-9.6
RD Chapter 10- Circles
RD Chapter 10- Circles Ex10.1
RD Chapter 10- Circles Ex10.2
RD Chapter 11- Constructions
RD Chapter 11- Constructions Ex-11.1
RD Chapter 11- Constructions Ex-11.2
RD Chapter 11- Constructions Ex-11.3
RD Chapter 12- Some Applications of Trigonometry
RD Chapter 12- Some Applications of Trigonometry Ex-12.1
RD Chapter 13- Probability
RD Chapter 13- Probability Ex-13.1
RD Chapter 13- Probability Ex-13.2
RD Chapter 14- Co-ordinate Geometry
RD Chapter 14- Co-ordinate Geometry Ex-14.1
RD Chapter 14- Co-ordinate Geometry Ex-14.2
RD Chapter 14- Co-ordinate Geometry Ex-14.3
RD Chapter 14- Co-ordinate Geometry Ex-14.4
RD Chapter 14- Co-ordinate Geometry Ex-14.5
RD Chapter 15- Areas Related to Circles
RD Chapter 15- Areas Related to Circles Ex-15.1
RD Chapter 15- Areas Related to Circles Ex-15.2
RD Chapter 15- Areas Related to Circles Ex-15.3
RD Chapter 15- Areas Related to Circles Ex-15.4
RD Chapter 16- Surface Areas and Volumes
RD Chapter 16- Surface Areas and Volumes Ex-16.1
RD Chapter 16- Surface Areas and Volumes Ex-16.2
RD Chapter 16- Surface Areas and Volumes Ex-16.3
NCERT Class 10 - Hindi Kritika कृतिका भाग 2
Chapter 1 माता का आँचल
Chapter 2 जॉर्ज पंचम की नाक
Chapter 3 साना-साना हाथ जोड़ि
Chapter 4 एही ठैयाँ झुलनी हेरानी हो रामा!
Chapter 5 मैं क्यों लिखता हूँ
NCERT Class 10 - Hindi Sanchayan Bhag संचयन भाग 2
Chapter 1 हरिहर काका
Chapter 2 सपनों के-से दिन
Chapter 3 टोपी शुक्ला
NCERT Class 10 - Foundation of IT
Chapter 1 Internet Basics
Chapter 2 Internet Services
Chapter 3 Database Concepts
Chapter 4 Microsoft Access
Chapter 5 HTML (HyperText Markup Language)
Chapter 6 Inserting Images and Links in HTML
Chapter 7 Working with Tables in HTML
Chapter 8 Introduction to XML
Chapter 9 Societal Impacts of IT
NCERT Class 11
NCERT Class 11 Maths
Chapter 1- Sets
Chapter 1 Sets Ex-1.1
Chapter 1 Sets Ex-1.2
Chapter 1 Sets Ex-1.3
Chapter 1 Sets Ex-1.4
Chapter 1 Sets Ex-1.5
Chapter 1 Sets Ex-1.6
Chapter 2- Relations and Functions
Chapter 2 Relations and Functions Ex-2.1
Chapter 2 Relations and Functions Ex-2.2
Chapter 2 Relations and Functions Ex-2.3
Chapter 3- Trigonometric Functions
Chapter 3 Trigonometric Functions Ex-3.1
Chapter 3 Trigonometric Functions Ex-3.2
Chapter 3 Trigonometric Functions Ex-3.3
Chapter 3 Trigonometric Functions Ex-3.4
Chapter 4- Principle of Mathematical Induction
Chapter 4 Principle of Mathematical Induction Ex-4.1
Chapter 5- Complex Numbers and Quadratic Equations
Chapter 5 Complex Numbers and Quadratic Equations Ex-5.1
Chapter 5 Complex Numbers and Quadratic Equations Ex-5.2
Chapter 5 Complex Numbers and Quadratic Equations Ex-5.3
Chapter 6- Linear Inequalities
Chapter 6 Linear Inequalities Ex-6.1
Chapter 6 Linear Inequalities Ex-6.2
Chapter 6 Linear Inequalities Ex-6.3
Chapter 7- Permutation and Combinations
Chapter 7 Permutations and Combinations Ex-7.1
Chapter 7 Permutations and Combinations Ex-7.2
Chapter 7 Permutations and Combinations Ex-7.3
Chapter 7 Permutations and Combinations Ex-7.4
Chapter 8- Binomial Theorem
Chapter 8 Binomial Theorem Ex-8.1
Chapter 8 Binomial Theorem Ex-8.2
Chapter 9- Sequences and Series
Chapter 9 Sequences and Series Ex-9.1
Chapter 9 Sequences and Series Ex-9.2
Chapter 9 Sequences and Series Ex-9.3
Chapter 9 Sequences and Series Ex-9.4
Chapter 10- Straight Lines
Chapter 10 Straight lines Ex-10.1
Chapter 10 Straight lines Ex-10.2
Chapter 10 Straight lines Ex-10.3
Chapter 11- Conic Sections
Chapter 11 Conic Sections Ex-11.1
Chapter 11 Conic Sections Ex-11.2
Chapter 11 Conic Sections Ex-11.3
Chapter 11 Conic Sections Ex-11.4
Chapter 12- Introduction to Three Dimensional Geometry
Chapter 12 Introduction to Three Dimensional Geometry Ex-12.1
Chapter 12 Introduction to Three Dimensional Geometry Ex-12.2
Chapter 12 Introduction to Three Dimensional Geometry Ex-12.3
Chapter 13- Limits and Derivatives
Chapter 13 Limits and Derivatives Ex-13.1
Chapter 13 Limits and Derivatives Ex-13.2
Chapter 14- Mathematical Reasoning
Chapter 14 Mathematical Reasoning Ex-14.1
Chapter 14 Mathematical Reasoning Ex-14.2
Chapter 14 Mathematical Reasoning Ex-14.3
Chapter 14 Mathematical Reasoning Ex-14.4
Chapter 14 Mathematical Reasoning Ex-14.5
Chapter 15- Statistics
Chapter 15 Statistics Ex-15.1
Chapter 15 Statistics Ex-15.2
Chapter 15 Statistics Ex-15.3
Chapter 16- Probability
Chapter 16 Probability Ex-16.1
Chapter 16 Probability Ex-16.2
Chapter 16 Probability Ex-16.3
NCERT Class 11 Physics
Chapter 1- Physical World
Chapter 2- Units and Measurements
Chapter 3- Motion in a Straight Line
Chapter 4- Motion in a plane
Chapter 5- Laws of motion
Chapter 6- Work Energy and power
Chapter 7- System of particles and Rotational Motion
Chapter 8- Gravitation
Chapter 9- Mechanical Properties Of Solids
Chapter 10- Mechanical Properties Of Fluids
Chapter 11- Thermal Properties of matter
Chapter 12- Thermodynamics
Chapter 13- Kinetic Theory
Chapter 14- Oscillations
Chapter 15- Waves
NCERT Class 11 Chemistry
Chapter 1- Some Basic Concepts of Chemistry
Chapter 2- Structure of The Atom
Chapter 3- Classification of Elements and Periodicity in Properties
Chapter 4- Chemical Bonding and Molecular Structure
Chapter 5- States of Matter
Chapter 6- Thermodynamics
Chapter 7- Equilibrium
Chapter 8- Redox Reactions
Chapter 9- Hydrogen
Chapter 10- The sBlock Elements
Chapter 11- The p Block Elements
Chapter 12- Organic Chemistry- Some Basic Principles and Techniques
Chapter 13- Hydrocarbons
Chapter 14- Environmental Chemistry
NCERT Class 11 Biology
Chapter 1- The Living World
Chapter 2- Biological Classification
Chapter 3- Plant Kingdom
Chapter 4- Animal Kingdom
Chapter 5- Morphology of Flowering Plants
Chapter 6- Anatomy of Flowering Plants
Chapter 7- Structural Organisation in Animals
Chapter 8- Cell The Unit of Life
Chapter 9- Biomolecules
Chapter 10- Cell Cycle and Cell Division
Chapter 11- Transport in Plants
Chapter 12- Mineral Nutrition
Chapter 13- Photosynthesis in Higher Plants
Chapter 14- Respiration in Plants
Chapter 15- Plant Growth and Development
Chapter 16- Digestion and Absorption
Chapter 17- Breathing and Exchange of Gases
Chapter 18- Body Fluids and Circulation
Chapter 19- Excretory Products and their Elimination
Chapter 20- Locomotion and Movement
Chapter 21- Neural Control and Coordination
Chapter 22- Chemical Coordination and Integration
NCERT Class 11 English
NCERT Class 11 English Hornbill Prose
Chapter 1- The Portrait of a Lady
Chapter 2- We’re Not Afraid to Die… If We Can All Be Together
Chapter 3- Discovering Tut- The Saga Continues
Chapter 4- Landscape of the Soul
Chapter 5- The Ailing Planet- the Green Movement’s Role
Chapter 6- The Browning Version
Chapter 7- The Adventure
Chapter 8- Silk Road
NCERT Class 11 English Hornbill Poem
Poem 1- A Photograph
Poem 2- The Laburnum Top
Poem 3- The Voice of the Rain
Poem 4- Childhood
Poem 5- Father to Son
NCERT Class 11 English Snapshots
Chapter 1 The Summer of the Beautiful White Horse
Chapter 2 The Address
Chapter 3 Rangas Marriage
Chapter 4 Albert Einstein at School
Chapter 5 Mothers Day
Chapter 6 The Ghat of the Only World
Chapter 7 Birth
Chapter 8 The Tale of Melon City
NCERT Class 11 Hindi
NCERT Class 11 Hindi Aroh (आरोह भाग 1)
Chapter 1 हम तौ एक एक करि जांनां-संतों देखत जग बौराना
Chapter 2 मेरे तो गिरधर गोपाल दूसरो न कोई-पग घुँघरू बाधि मीरां नाची
Chapter 3 पथिक
Chapter 4 वे आँखें
Chapter 5 घर की याद
Chapter 6 चंपा काले-काले अच्छर नहीं चीन्हती
Chapter 7 गजल
Chapter 8 हे भूख - मत मचल-हे मेरे जूही के फूल जैसे ईश्वर
Chapter 9 सबसे खतरनाक
Chapter 10 आओ-मिलकर बचाएँ
Chapter 11 नमक का दारोगा
Chapter 12 मियाँ नसीरुद्दीन
Chapter 13 अपू के साथ ढाई साल
Chapter 14 विदाई-संभाषण
Chapter 15 गलता लोहा
Chapter 16 स्पीति में बारिश
Chapter 17 रजनी
Chapter 18 जामुन का पेड़
Chapter 19 भारत माता
Chapter 20 आत्मा का ताप
NCERT Class 11 Hindi Vitan वितान भाग 1
Chapter 1 भारतीय गायिकाओं में बेजोड़ - लता मंगेशकर
Chapter 2 राजस्थान की रजत बूँदें
Chapter 3 आलो-आँधारि
NCERT Class 11 History
Chapter 1- From the Beginning of Time
Chapter 2 Writing and City Life
Chapter 3 An Empire Across Three Continents
Chapter 4 The Central Islamic Lands
Chapter 5 Nomadic Empires
Chapter 6 The Three Orders
Chapter 7 Changing Cultural Traditions
Chapter 8 Confrontation of Cultures
Chapter 9 The Industrial Revolution
Chapter 10 Displacing Indigenous Peoples
Chapter 11 Paths to Modernization
NCERT Class 11 Geography
Chapter 1- Geography as a Discipline
Chapter 2- The Origin and Evolution of the Earth
Chapter 3- Interior of the Earth
Chapter 4- Distribution of Oceans and Continents
Chapter 5- Minerals and Rocks
Chapter 6- Geomorphic Processes
Chapter 7- Landforms and their Evolution
Chapter 8- Composition and Structure of Atmosphere
Chapter 9- Solar Radiation, Heat Balance and Temperature
Chapter 10- Atmospheric Circulation and Weather Systems
Chapter 11- Water in the Atmosphere
Chapter 12- World Climate and Climate Change
Chapter 13- Water (Oceans)
Chapter 14- Movements of Ocean Water
Chapter 15- Life on the Earth
Chapter 16- Biodiversity and Conversation
NCERT Class 11 Economics
NCERT Class 11 Economics – Indian Economic Development
Chapter 1- Indian Economy on the Eve of Independence
Chapter 2 – Indian Economy 1950-1990
Chapter 3 – Liberalization- Privatization and Globalization- An Appraisal
Chapter 4 – Poverty
Chapter 5 – Human Capital formation in India
Chapter 6 – Rural Development
Chapter 7 – Employment- Growth Informalisation and other Issues
Chapter 8 – Infrastructure
Chapter 9 – Environment and Sustainable Development
Chapter 10 – Comparative Development Experiences of India and its Neighbors
NCERT Class 11 Economics – Statistics for Economics
Chapter 1- Introduction
Chapter 2- Collection of Data
Chapter 3- Organisation of Data
Chapter 4- Presentation of Data
Chapter 5- Measures of Central Tendency
Chapter 6- Measures of Dispersion
Chapter 7- Correlation
Chapter 8- Index Numbers
NCERT Class 11 Political Science
NCERT Class 11 Political Science Indian Constitution at Work
Chapter 1- Constitution- Why and How
Chapter 2- Rights and Duties in the Indian Constitution
Chapter 3- Election and Representation
Chapter 4- Executive
Chapter 5- Legislature
Chapter 6- Judiciary
Chapter 7- Federalism
Chapter 8- Local Governments
Chapter 9- Constitution as a Living Document
Chapter 10- The Philosophy of the Constitution
NCERT Class 11 Political Science Political Theory
Chapter 1- Political Theory- An Introduction
Chapter 2- Freedom
Chapter 3- Equality
Chapter 4- Social Justice
Chapter 5- Rights
Chapter 6- Citizenship
Chapter 7- Nationalism
Chapter 8- Secularism
Chapter 9- Peace
NCERT Class 11 Computer Science (Python)
Chapter 1- Computer overview and its Basics
Chapter 2- Software Concepts
Chapter 3- Data Representation
Chapter 4- Microprocessor and Memory Concepts
Chapter 5- Programming Methodology
Chapter 6- Algorithms and Flowcharts
Chapter 7- Introduction to Python
Chapter 8- Getting Started with Python
Chapter 9- Operators in Python
Chapter 10- Functions
Chapter 11- Conditional and Looping Constructs
Chapter 12- Strings
Chapter 13- Lists, Dictionaries and Tuples
NCERT Class 11 Maths RD Sharma Solutions
RD Chapter 1- Sets
RD Chapter 1- Sets Ex-1.1
RD Chapter 1- Sets Ex-1.2
RD Chapter 1- Sets Ex-1.3
RD Chapter 1- Sets Ex-1.4
RD Chapter 1- Sets Ex-1.5
RD Chapter 1- Sets Ex-1.6
RD Chapter 1- Sets Ex-1.7
RD Chapter 1- Sets Ex-1.8
RD Chapter 2- Relations
RD Chapter 2- Relations Ex-2.1
RD Chapter 2- Relations Ex-2.2
RD Chapter 2- Relations Ex-2.3
RD Chapter 3- Functions
RD Chapter 3- Functions Ex-3.1
RD Chapter 3- Functions Ex-3.2
RD Chapter 3- Functions Ex-3.3
RD Chapter 3- Functions Ex-3.4
RD Chapter 4- Measurement of Angles
RD Chapter 5- Trigonometric Functions
RD Chapter 5- Trigonometric Functions Ex-5.1
RD Chapter 5- Trigonometric Functions Ex-5.2
RD Chapter 5- Trigonometric Functions Ex-5.3
RD Chapter 6- Graphs of Trigonometric Functions
RD Chapter 6- Graphs of Trigonometric Functions Ex-6.1
RD Chapter 6- Graphs of Trigonometric Functions Ex-6.2
RD Chapter 6- Graphs of Trigonometric Functions Ex-6.3
RD Chapter 7- Trigonometric Ratios of Compound Angles
RD Chapter 7- Trigonometric Ratios of Compound Angles Ex-7.1
RD Chapter 7- Trigonometric Ratios of Compound Angles Ex-7.2
RD Chapter 8- Transformation Formulae
RD Chapter 8- Transformation Formulae Ex-8.1
RD Chapter 8- Transformation Formulae Ex-8.2
RD Chapter 9- Trigonometric Ratios of Multiple and Submultiple Angles
RD Chapter 9- Trigonometric Ratios of Multiple and Submultiple Angles Ex-9.1
RD Chapter 9- Trigonometric Ratios of Multiple and Submultiple Angles Ex-9.2
RD Chapter 9- Trigonometric Ratios of Multiple and Submultiple Angles Ex-9.3
RD Chapter 10- Sine and Cosine Formulae and Their Applications
RD Chapter 10- Sine and Cosine Formulae and Their Applications Ex-10.1
RD Chapter 10- Sine and Cosine Formulae and Their Applications Ex-10.2
RD Chapter 11- Trigonometric Equations
RD Chapter 12- Mathematical Induction
RD Chapter 12- Mathematical Induction Ex-12.1
RD Chapter 12- Mathematical Induction Ex-12.2
RD Chapter 13- Complex Numbers
RD Chapter 13- Complex Numbers Ex-13.1
RD Chapter 13- Complex Numbers Ex-13.2
RD Chapter 13- Complex Numbers Ex-13.3
RD Chapter 13- Complex Numbers Ex-13.4
RD Chapter 14- Quadratic Equations
RD Chapter 14- Quadratic Equations Ex-14.1
RD Chapter 14- Quadratic Equations Ex-14.2
RD Chapter 15- Linear Inequations
RD Chapter 15- Linear Inequations Ex-15.1
RD Chapter 15- Linear Inequations Ex-15.2
RD Chapter 15- Linear Inequations Ex-15.3
RD Chapter 15- Linear Inequations Ex-15.4
RD Chapter 15- Linear Inequations Ex-15.5
RD Chapter 15- Linear Inequations Ex-15.6
RD Chapter 16- Permutations
RD Chapter 16- Permutations Ex-16.1
RD Chapter 16- Permutations Ex-16.2
RD Chapter 16- Permutations Ex-16.3
RD Chapter 16- Permutations Ex-16.4
RD Chapter 16- Permutations Ex-16.5
RD Chapter 17- Combinations
RD Chapter 17- Combinations Ex-17.1
RD Chapter 17- Combinations Ex-17.2
RD Chapter 17- Combinations Ex-17.3
RD Chapter 18- Binomial Theorem
RD Chapter 18- Binomial Theorem Ex-18.1
RD Chapter 18- Binomial Theorem Ex-18.2
RD Chapter 19- Arithmetic Progressions
RD Chapter 19- Arithmetic Progressions Ex-19.1
RD Chapter 19- Arithmetic Progressions Ex-19.2
RD Chapter 19- Arithmetic Progressions Ex-19.3
RD Chapter 19- Arithmetic Progressions Ex-19.4
RD Chapter 19- Arithmetic Progressions Ex-19.5
RD Chapter 19- Arithmetic Progressions Ex-19.6
RD Chapter 19- Arithmetic Progressions Ex-19.7
RD Chapter 20- Geometric Progressions
RD Chapter 20- Geometric Progressions Ex-20.1
RD Chapter 20- Geometric Progressions Ex-20.2
RD Chapter 20- Geometric Progressions Ex-20.3
RD Chapter 20- Geometric Progressions Ex-20.4
RD Chapter 20- Geometric Progressions Ex-20.5
RD Chapter 20- Geometric Progressions Ex-20.6
RD Chapter 21- Some Special Series
RD Chapter 21- Some Special Series Ex-21.1
RD Chapter 21- Some Special Series Ex-21.2
RD Chapter 22- Brief Review of Cartesian System of Rectangular Coordinates
RD Chapter 22- Brief Review of Cartesian System of Rectangular Coordinates Ex-22.1
RD Chapter 22- Brief Review of Cartesian System of Rectangular Coordinates Ex-22.2
RD Chapter 22- Brief Review of Cartesian System of Rectangular Coordinates Ex-22.3
RD Chapter 23- The Straight Lines
RD Chapter 23- The Straight Lines Ex-23.1
RD Chapter 23- The Straight Lines Ex-23.2
RD Chapter 23- The Straight Lines Ex-23.3
RD Chapter 23- The Straight Lines Ex-23.4
RD Chapter 23- The Straight Lines Ex-23.5
RD Chapter 23- The Straight Lines Ex-23.6
RD Chapter 23- The Straight Lines Ex-23.7
RD Chapter 23- The Straight Lines Ex-23.8
RD Chapter 23- The Straight Lines Ex-23.9
RD Chapter 23- The Straight Lines Ex-23.10
RD Chapter 23- The Straight Lines Ex-23.11
RD Chapter 23- The Straight Lines Ex-23.12
RD Chapter 23- The Straight Lines Ex-23.13
RD Chapter 23- The Straight Lines Ex-23.14
RD Chapter 23- The Straight Lines Ex-23.15
RD Chapter 23- The Straight Lines Ex-23.16
RD Chapter 23- The Straight Lines Ex-23.17
RD Chapter 23- The Straight Lines Ex-23.18
RD Chapter 23- The Straight Lines Ex-23.19
RD Chapter 24- The Circle
RD Chapter 24- The Circle Ex-24.1
RD Chapter 24- The Circle Ex-24.2
RD Chapter 24- The Circle Ex-24.3
RD Chapter 25- Parabola
RD Chapter 26- Ellipse
RD Chapter 27- Hyperbola
RD Chapter 28- Introduction to 3D coordinate geometry
RD Chapter 28- Introduction to 3D coordinate geometry Ex-28.1
RD Chapter 28- Introduction to 3D coordinate geometry Ex-28.2
RD Chapter 28- Introduction to 3D coordinate geometry Ex-28.3
RD Chapter 29- Limits
RD Chapter 29- Limits Ex-29.1
RD Chapter 29- Limits Ex-29.2
RD Chapter 29- Limits Ex-29.3
RD Chapter 29- Limits Ex-29.4
RD Chapter 29- Limits Ex-29.5
RD Chapter 29- Limits Ex-29.6
RD Chapter 29- Limits Ex-29.7
RD Chapter 29- Limits Ex-29.8
RD Chapter 29- Limits Ex-29.9
RD Chapter 29- Limits Ex-29.10
RD Chapter 29- Limits Ex-29.11
RD Chapter 30- Derivatives
RD Chapter 30- Derivatives Ex-30.1
RD Chapter 30- Derivatives Ex-30.2
RD Chapter 30- Derivatives Ex-30.3
RD Chapter 30- Derivatives Ex-30.4
RD Chapter 30- Derivatives Ex-30.5
RD Chapter 31- Mathematical Reasoning
RD Chapter 31- Mathematical Reasoning Ex-31.1
RD Chapter 31- Mathematical Reasoning Ex-31.2
RD Chapter 31- Mathematical Reasoning Ex-31.3
RD Chapter 31- Mathematical Reasoning Ex-31.4
RD Chapter 31- Mathematical Reasoning Ex-31.5
RD Chapter 31- Mathematical Reasoning Ex-31.6
RD Chapter 32- Statistics
RD Chapter 32- Statistics Ex-32.1
RD Chapter 32- Statistics Ex-32.2
RD Chapter 32- Statistics Ex-32.3
RD Chapter 32- Statistics Ex-32.4
RD Chapter 32- Statistics Ex-32.5
RD Chapter 32- Statistics Ex-32.6
RD Chapter 32- Statistics Ex-32.7
RD Chapter 33- Probability
RD Chapter 33- Probability Ex-33.1
RD Chapter 33- Probability Ex-33.2
RD Chapter 33- Probability Ex-33.3
RD Chapter 33- Probability Ex-33.4
NCERT Class 11 Sociology
Chapter 1 Sociology and Society
Chapter 2 Terms- Concepts and their Use in Sociology
Chapter 3 Understanding Social Institutions
Chapter 4 Culture and Socialisation
Chapter 5 Doing Sociology- Research Methods
NCERT Class 11 Psychology
Chapter 1 What is Psychology
Chapter 2 Methods of Enquiry in Psychology
Chapter 3 The Bases of Human Behaviour
Chapter 4 Human Development
Chapter 5 Sensory Attentional And Perceptual Processes
Chapter 6 Learning
Chapter 7 Human Memory
Chapter 8 Thinking
Chapter 9 Motivation And Emotion
NCERT Class 11 Business Studies
Chapter 1 - Business Trade and Commerce
Chapter 2 - Forms of Business Organisations
Chapter 3 - Private Public and Global Enterprises
Chapter 4 - Business Services
Chapter 5 - Emerging Modes of Business
Chapter 6 - Social Responsibility of Business and Business Ethics
Chapter 7 - Formation of a Company
Chapter 8 - Sources of Business Finance
Chapter 9 - Small Business and Entrepreneurship Development
Chapter 10 - Internal Trade
Chapter 11 - International Business
NCERT Class 11 Accountancy
NCERT Class 11 Accountancy- I
Chapter 1 - Introduction to Accounting
Chapter 2 - Theory Base of Accounting
Chapter 3 - Recording of Transactions - I
Chapter 4 - Recording of Transactions - II
Chapter 5 - Bank Reconciliation Statement
Chapter 6 - Trial Balance and Rectification of Errors
Chapter 7 - Depreciation Provisions and Reserves
Chapter 8 - Bills of Exchange
NCERT Class 11 Accountancy- II
Chapter 1 - Financial Statements - I
Chapter 2 - Financial Statements - II
Chapter 3 - Accounts from Incomplete Records
Chapter 4 - Applications of Computers in Accounting
Chapter 5 - Computerised Accounting System
NCERT Class 12
NCERT Class 12 Physics
Chapter 1- Electric Charges And Fields
Chapter 2 Electrostatic Potential And Capacitance
Chapter 3 Current Electricity
Chapter 4 Moving Charges And Magnetism
Chapter 5 Magnetism And Matter
Chapter 6 Electromagnetic Induction
Chapter 7 Alternating Current
Chapter 8 Electromagnetic Waves
Chapter 9 Ray Optics and Optical Instruments
Chapter 10 Wave Optics
Chapter 11 Dual Nature Of Radiation And Matter
Chapter 12 Atoms
Chapter 13 Nuclei
Chapter 14 Semiconductor Electronics Materials Devices And Simple Circuits
Chapter 15 Communication Systems
NCERT Class 12 Chemistry
Chapter 1- The Solid State
Chapter 2- Solutions
Chapter 3- Electrochemistry
Chapter 4- Chemical Kinetics
Chapter 5- Surface Chemistry
Chapter 6- General Principles and Processes of Isolation of Elements
Chapter 7- The p-Block Elements
Chapter 8- The d and f Block Elements
Chapter 9- Coordination Compounds
Chapter 10- Haloalkanes and Haloarenes
Chapter 11- Alcohols-Phenols and Ethers
Chapter 12- Aldehydes-Ketones and Carboxylic Acids
Chapter 13- Amines
Chapter 14- Biomolecules
Chapter 15- Polymers
Chapter 16- Chemistry in Everyday Life
NCERT Class 12 Biology
Chapter 1- Reproduction in Organisms
Chapter 2- Sexual Reproduction in Flowering Plants
Chapter 3- Human Reproduction
Chapter 4- Reproductive Health
Chapter 5- Principles of Inheritance and Variation
Chapter 6- Molecular Basis of Inheritance
Chapter 7- Evolution
Chapter 8- Human Health and Disease
Chapter 9- Strategies for Enhancement in Food Production
Chapter 10- Microbes in Human Welfare
Chapter 11- Biotechnology-Principles and Processes
Chapter 12- Biotechnology and its Applications
Chapter 13- Organisms and Populations
Chapter 14- Ecosystem
Chapter 15- Biodiversity and Conservation
Chapter 16- Environmental Issues
NCERT Class 12 Maths
Chapter 1- Relations and Functions
Chapter 1- Relations and Functions Ex-1.1
Chapter 1- Relations and Functions Ex-1.2
Chapter 1- Relations and Functions Ex-1.3
Chapter 1- Relations and Functions Ex-1.4
Chapter 2- Inverse Trigonometric Functions
Chapter 2- Inverse Trigonometric Functions Ex-2.1
Chapter 2- Inverse Trigonometric Functions Ex-2.2
Chapter 3- Matrices
Chapter 3- Matrices Ex-3.1
Chapter 3- Matrices Ex-3.2
Chapter 3- Matrices Ex-3.3
Chapter 3- Matrices Ex-3.4
Chapter 4- Determinants
Chapter 4- Determinants Ex-4.1
Chapter 4- Determinants Ex-4.2
Chapter 4- Determinants Ex-4.3
Chapter 4- Determinants Ex-4.4
Chapter 4- Determinants Ex-4.5
Chapter 4- Determinants Ex-4.6
Chapter 5- Continuity and Differentiability
Chapter 5- Continuity and Differentiability Ex-5.1
Chapter 5- Continuity and Differentiability Ex-5.2
Chapter 5- Continuity and Differentiability Ex-5.3
Chapter 5- Continuity and Differentiability Ex-5.4
Chapter 5- Continuity and Differentiability Ex-5.5
Chapter 5- Continuity and Differentiability Ex-5.6
Chapter 5- Continuity and Differentiability Ex-5.7
Chapter 5- Continuity and Differentiability Ex-5.8
Chapter 6- Application of Derivatives
Chapter 6- Application of Derivatives Ex-6.1
Chapter 6- Application of Derivatives Ex-6.2
Chapter 6- Application of Derivatives Ex-6.3
Chapter 6- Application of Derivatives Ex-6.4
Chapter 6- Application of Derivatives Ex-6.5
Chapter 7- Integrals
Chapter 7- Integrals Ex-7.1
Chapter 7- Integrals Ex-7.2
Chapter 7- Integrals Ex-7.3
Chapter 7- Integrals Ex-7.4
Chapter 7- Integrals Ex-7.5
Chapter 7- Integrals Ex-7.6
Chapter 7- Integrals Ex-7.7
Chapter 7- Integrals Ex-7.8
Chapter 7- Integrals Ex-7.9
Chapter 7- Integrals Ex-7.10
Chapter 7- Integrals Ex-7.11
Chapter 8- Application of Integrals
Chapter 8- Application of Integrals Ex-8.1
Chapter 8- Application of Integrals Ex-8.2
Chapter 9- Differential Equations
Chapter 9- Differential Equations Ex-9.1
Chapter 9- Differential Equations Ex-9.2
Chapter 9- Differential Equations Ex-9.3
Chapter 9- Differential Equations Ex-9.4
Chapter 9- Differential Equations Ex-9.5
Chapter 9- Differential Equations Ex-9.6
Chapter 10- Vector Algebra
Chapter 10- Vector Algebra Ex-10.1
Chapter 10- Vector Algebra Ex-10.2
Chapter 10- Vector Algebra Ex-10.3
Chapter 10- Vector Algebra Ex-10.4
Chapter 11- Three Dimensional Geometry
Chapter 11- Three Dimensional Geometry Ex-11.1
Chapter 11- Three Dimensional Geometry Ex-11.2
Chapter 11- Three Dimensional Geometry Ex-11.3
Chapter 12- Linear Programming
Chapter 12- Linear Programming Ex-12.1
Chapter 12- Linear Programming Ex-12.2
Chapter 13- Probability
Chapter 13- Probability Ex-13.1
Chapter 13- Probability Ex-13.2
Chapter 13- Probability Ex-13.3
Chapter 13- Probability Ex-13.4
Chapter 13- Probability Ex-13.5
NCERT Class 12 English
NCERT Class 12 English Flamingo Prose-Poetry
Chapter 1- The Last Lesson
Chapter 2- Lost Spring
Chapter 3- Deep Water
Chapter 4- The Rattrap
Chapter 5- Indigo
Chapter 6- Poets and Pancakes
Chapter 7- The Interview
Chapter 8- Going Places
Chapter 9- My Mother at Sixty-six
Chapter 10- An Elementary School Classroom in a Slum
Chapter 11 Keeping Quiet
Chapter 12- A Thing of Beauty
Chapter 13- A Roadside Stand
Chapter 14- Aunt Jennifer’s Tigers
NCERT Class 12 English Vistas
Chapter 2- The Tiger King
Chapter 4- The Enemy
Chapter 5- Should Wizard Hit Mommy
Chapter 6- On the Face of It
Chapter 7- Evans Tries an O-level
Chapter 8- Memories of Childhood
Chapter 1- The Third Level
Chapter 3- Journey to the end of the Earth
NCERT Class 12 Hindi
NCERT Class 12 Hindi Aroh आरोह भाग 2
Chapter 1- आत्म-परिचय, एक गीत
Chapter 2- पतंग
Chapter 3- कविता के बहाने, बात सीधी थी पर
Chapter 4- कैमरे में बंद अपाहिज
Chapter 5- सहर्ष स्वीकारा है
Chapter 6- उषा
Chapter 7- बादल राग
Chapter 8- कवितावली (उत्तर कांड से), लक्ष्मण-मूच्छ और राम का विलाप
Chapter 9- रुबाइयाँ, गज़ल
Chapter 10- छोटा मेरा खेत, बगुलों के पंख
Chapter 11- भक्तिन
Chapter 12- बाजार दर्शन
Chapter 13- काले मेघा पानी दे
Chapter 14- पहलवान की ढोलक
Chapter 15- चार्ली चैप्लिन यानी हम सब
Chapter 16- नमक
Chapter 17- शिरीष के फूल
Chapter 18- श्रम-विभाजन और जाति-प्रथा, मेरी कल्पना का आदर्श समाज
NCERT Class 12 Hindi Vitan वितान भाग 2
Chapter 1- सिल्वर वैडिंग
Chapter 2- जूझ
Chapter 3- अतीत में दबे पाँव
Chapter 4- डायरी के पन्ने
NCERT Class 12 History
Chapter 1- Bricks, Beads and Bones The Harappan Civilisation
Chapter 2- Kings, Farmers and Towns Early States and Economies
Chapter 3- Kinship, Caste and Class Early Societies
Chapter 4- Thinkers, Beliefs and Buildings Cultural Developments
Chapter 5- Through the Eyes of Travellers Perceptions of Society
Chapter 6- Bhakti-Sufi Traditions Changes in Religious Beliefs and Devotional Texts
Chapter 7- An Imperial Capital Vijayanagara
Chapter 8- Peasants Zamindars and the State Agrarian Society
Chapter 9- Kings and Chronicles The Mughal Courts
Chapter 10- Colonialism and the Countryside Exploring Official Archives
Chapter 11- Rebels and the Raj The Revolt of 1857 and its Representations
Chapter 12- Colonial Cities Urbanisation, Planning and Architecture
Chapter 13- Mahatma Gandhi and the Nationalist Movement
Chapter 14- Understanding Partition Politics, Memories, Experiences
Chapter 15- Framing the Constitution The Beginning of a New Era
NCERT Class 12 Geography
NCERT Class 12 Geography- Fundamentals of Human Geography
Chapter 1- Human Geography (Nature and Scope)
Chapter 2- The World Population (Distribution, Density and Growth)
Chapter 3- Population Composition
Chapter 4- Human Development
Chapter 5- Primary Activities
Chapter 6- Secondary Activities
Chapter 7- Tertiary and Quaternary Activities
Chapter 8- Transport and Communication
Chapter 9- International Trade
Chapter 10- Human Settlements
NCERT Class 12 Geography- India People and Economy
Chapter 1- Population- Distribution-Density-Growth and Composition
Chapter 2- Migration- Types, Causes and Consequences
Chapter 3- Human Development
Chapter 4- Human Settlements
Chapter 5- Land Resources and Agriculture
Chapter 6- Water Resources
Chapter 7- Mineral and Energy Resources
Chapter 8- Manufacturing Industries
Chapter 9- Planning and Sustainable Development in Indian Context
Chapter 10- Transport And Communication
Chapter 11- International Trade
Chapter 12- Geographical Perspective on Selected Issues and Problems
NCERT Class 12 Economics
NCERT Class 12 Micro Economics
Chapter 1- Introduction to Economics
Chapter 2- Consumer Equilibrium
Chapter 3- Demand
Chapter 4- Elasticity of Demand
Chapter 5- Production
Chapter 6- Cost
Chapter 7- Supply
Chapter 8- Revenue
Chapter 9- Producer Equilibrium
Chapter 10- Perfect Competition
Chapter 11- Non-Competitive Market
Chapter 12- Market Equilibrium with Simple Applications
NCERT Class 12 Macro Economics
Chapter 1- Introduction to Macroeconomics and its Concepts
Chapter 2- National Income and Related Aggregates
Chapter 3- Money
Chapter 4- Banking
Chapter 5- Aggregate Demand and Its Related Concepts
Chapter 6- National Income Determination and Multiplier
Chapter 7- Excess Demand and Deficient Demand
Chapter 8- Government Budget and the Economy
Chapter 9- Foreign Exchange Rate
Chapter 10- Balance of Payment
NCERT Class 12 Political Science
NCERT Class 12 Political Science- Contemporary World Politics
Chapter 1- The Cold War Era
Chapter 2- The End of Bipolarity
Chapter 3- US Hegemony in World Politics
Chapter 4- Alternative Centres of Power
Chapter 5- Contemporary South Asia
Chapter 6- International Organisations
Chapter 7- Security in the Contemporary World
Chapter 8- Environment and Natural Resources
Chapter 9- Globalisation
NCERT Class 12 Political Science- Politics In India Since Independence
Chapter 1- Challenges of Nation Building
Chapter 2- Era of One Party Dominance
Chapter 3- Politics of Planned Development
Chapter 4- India’s External Relations
Chapter 5- Challenges to and Restoration of Congress System
Chapter 6- The Crisis of Democratic Order
Chapter 7- Rise of Popular Movements
Chapter 8- Regional Aspirations
Chapter 9- Recent Developments in Indian Politics
NCERT Class 12 Business Studies
Chapter 1- Nature and Significance of Management
Chapter 2- Principles of Management
Chapter 3- Business Environment
Chapter 4- Planning
Chapter 5- Organising
Chapter 6- Staffing
Chapter 7- Directing
Chapter 8- Controlling
Chapter 9- Financial Management
Chapter 10- Financial Market
Chapter 11- Marketing
Chapter 12- Consumer Protection
NCERT Class 12 Computer Science C plus plus
Chapter 1- C plus plus Revision Tour
Chapter 2- Object Oriented Programming in C plus plus
Chapter 3- Implementation of OOP Concepts in C plus plus
Chapter 4- Constructor and Destructor
Chapter 5- Inheritance
Chapter 6- Data File Handling
Chapter 7- Pointers
Chapter 8- Arrays
Chapter 9- Stack
Chapter 10- Queue
Chapter 11- Database Concepts
Chapter 12- Structured Query Language
Chapter 13- Boolean Algebra
Chapter 14- Networking and Open Source Concepts
NCERT Class 12 Maths RD Sharma Solutions
RD Chapter 1- Relations
RD Chapter 1- Relations Ex-1.1
RD Chapter 1- Relations Ex-1.2
RD Chapter 2- Functions
RD Chapter 2- Functions Ex-2.1
RD Chapter 2- Functions Ex-2.2
RD Chapter 2- Functions Ex-2.3
RD Chapter 2- Functions Ex-2.4
RD Chapter 3- Binary Operations
RD Chapter 3- Binary Operations Ex-3.1
RD Chapter 3- Binary Operations Ex-3.2
RD Chapter 3- Binary Operations Ex-3.3
RD Chapter 3- Binary Operations Ex-3.4
RD Chapter 3- Binary Operations Ex-3.5
RD Chapter 4- Inverse Trigonometric Functions
RD Chapter 4- Inverse Trigonometric Functions Ex-4.1
RD Chapter 4- Inverse Trigonometric Functions Ex-4.2
RD Chapter 4- Inverse Trigonometric Functions Ex-4.3
RD Chapter 4- Inverse Trigonometric Functions Ex-4.4
RD Chapter 4- Inverse Trigonometric Functions Ex-4.5
RD Chapter 4- Inverse Trigonometric Functions Ex-4.6
RD Chapter 4- Inverse Trigonometric Functions Ex-4.7
RD Chapter 4- Inverse Trigonometric Functions Ex-4.8
RD Chapter 4- Inverse Trigonometric Functions Ex-4.9
RD Chapter 4- Inverse Trigonometric Functions Ex-4.10
RD Chapter 4- Inverse Trigonometric Functions Ex-4.11
RD Chapter 4- Inverse Trigonometric Functions Ex-4.12
RD Chapter 4- Inverse Trigonometric Functions Ex-4.13
RD Chapter 4- Inverse Trigonometric Functions Ex-4.14
RD Chapter 5- Algebra of Matrices
RD Chapter 5- Algebra of Matrices Ex-5.1
RD Chapter 5- Algebra of Matrices Ex-5.2
RD Chapter 5- Algebra of Matrices Ex-5.3
RD Chapter 5- Algebra of Matrices Ex-5.4
RD Chapter 5- Algebra of Matrices Ex-5.5
RD Chapter 6- Determinants
RD Chapter 6- Determinants Ex-6.1
RD Chapter 6- Determinants Ex-6.2
RD Chapter 6- Determinants Ex-6.3
RD Chapter 6- Determinants Ex-6.4
RD Chapter 6- Determinants Ex-6.5
RD Chapter 7- Adjoint and Inverse of a Matrix
RD Chapter 7- Adjoint and Inverse of a Matrix Ex-7.1
RD Chapter 7- Adjoint and Inverse of a Matrix Ex-7.2
RD Chapter 8- Solution of Simultaneous Linear Equations
RD Chapter 8- Solution of Simultaneous Linear Equations Ex-8.1
RD Chapter 8- Solution of Simultaneous Linear Equations Ex-8.2
RD Chapter 9- Continuity
RD Chapter 9- Continuity Ex-9.1
RD Chapter 9- Continuity Ex-9.2
RD Chapter 10- Differentiability
RD Chapter 10- Differentiability Ex-10.1
RD Chapter 10- Differentiability Ex-10.2
RD Chapter 11- Differentiation
RD Chapter 11- Differentiation Ex-11.1
RD Chapter 11- Differentiation Ex-11.2
RD Chapter 11- Differentiation Ex-11.3
RD Chapter 11- Differentiation Ex-11.4
RD Chapter 11- Differentiation Ex-11.5
RD Chapter 11- Differentiation Ex-11.6
RD Chapter 11- Differentiation Ex-11.7
RD Chapter 11- Differentiation Ex-11.8
RD Chapter 12- Higher Order Derivatives
RD Chapter 13- Derivative as a Rate Measurer
RD Chapter 13- Derivative as a Rate Measurer Ex-13.1
RD Chapter 13- Derivative as a Rate Measurer Ex-13.2
RD Chapter 14- Differentials-Errors and Approximations
RD Chapter 14- Differentials-Errors and Approximations Ex-14.1
RD Chapter 15- Mean Value Theorems
RD Chapter 15- Mean Value Theorems Ex-15.1
RD Chapter 15- Mean Value Theorems Ex-15.2
RD Chapter 16- Tangents and Normals
RD Chapter 16- Tangents and Normals Ex-16.1
RD Chapter 16- Tangents and Normals Ex-16.2
RD Chapter 16- Tangents and Normals Ex-16.3
RD Chapter 17- Increasing and Decreasing Functions
RD Chapter 17- Increasing and Decreasing Functions Ex-17.1
RD Chapter 17- Increasing and Decreasing Functions Ex-17.2
RD Chapter 18- Maxima and Minima
RD Chapter 18- Maxima and Minima Ex-18.1
RD Chapter 18- Maxima and Minima Ex-18.2
RD Chapter 18- Maxima and Minima Ex-18.3
RD Chapter 18- Maxima and Minima Ex-18.4
RD Chapter 18- Maxima and Minima Ex-18.5
RD Chapter 19- Indefinite Integrals
RD Chapter 19- Indefinite Integrals Ex-19.1
RD Chapter 19- Indefinite Integrals Ex-19.2
RD Chapter 19- Indefinite Integrals Ex-19.3
RD Chapter 19- Indefinite Integrals Ex-19.4
RD Chapter 19- Indefinite Integrals Ex-19.5
RD Chapter 19- Indefinite Integrals Ex-19.6
RD Chapter 19- Indefinite Integrals Ex-19.7
RD Chapter 19- Indefinite Integrals Ex-19.8
RD Chapter 19- Indefinite Integrals Ex-19.9
RD Chapter 19- Indefinite Integrals Ex-19.10
RD Chapter 19- Indefinite Integrals Ex-19.11
RD Chapter 19- Indefinite Integrals Ex-19.12
RD Chapter 19- Indefinite Integrals Ex-19.13
RD Chapter 19- Indefinite Integrals Ex-19.14
RD Chapter 19- Indefinite Integrals Ex-19.15
RD Chapter 19- Indefinite Integrals Ex-19.16
RD Chapter 19- Indefinite Integrals Ex-19.17
RD Chapter 19- Indefinite Integrals Ex-19.18
RD Chapter 19- Indefinite Integrals Ex-19.19
RD Chapter 19- Indefinite Integrals Ex-19.20
RD Chapter 19- Indefinite Integrals Ex-19.21
RD Chapter 19- Indefinite Integrals Ex-19.22
RD Chapter 19- Indefinite Integrals Ex-19.23
RD Chapter 19- Indefinite Integrals Ex-19.24
RD Chapter 19- Indefinite Integrals Ex-19.25
RD Chapter 19- Indefinite Integrals Ex-19.26
RD Chapter 19- Indefinite Integrals Ex-19.27
RD Chapter 19- Indefinite Integrals Ex-19.28
RD Chapter 19- Indefinite Integrals Ex-19.29
RD Chapter 19- Indefinite Integrals Ex-19.30
RD Chapter 19- Indefinite Integrals Ex-19.31
RD Chapter 19- Indefinite Integrals Ex-19.32
RD Chapter 20- Definite Integrals
RD Chapter 20- Definite Integrals Ex-20.1
RD Chapter 20- Definite Integrals Ex-20.2
RD Chapter 20- Definite Integrals Ex-20.3
RD Chapter 20- Definite Integrals Ex-20.4
RD Chapter 20- Definite Integrals Ex-20.5
RD Chapter 21- Areas of Bounded Regions
RD Chapter 21- Areas of Bounded Regions Ex-21.1
RD Chapter 21- Areas of Bounded Regions Ex-21.2
RD Chapter 21- Areas of Bounded Regions Ex-21.3
RD Chapter 21- Areas of Bounded Regions Ex-21.4
RD Chapter 22- Differential Equations
RD Chapter 22- Differential Equations Ex-22.1
RD Chapter 22- Differential Equations Ex-22.2
RD Chapter 22- Differential Equations Ex-22.3
RD Chapter 22- Differential Equations Ex-22.4
RD Chapter 22- Differential Equations Ex-22.5
RD Chapter 22- Differential Equations Ex-22.6
RD Chapter 22- Differential Equations Ex-22.7
RD Chapter 22- Differential Equations Ex-22.8
RD Chapter 22- Differential Equations Ex-22.9
RD Chapter 22- Differential Equations Ex-22.10
RD Chapter 22- Differential Equations Ex-22.11
RD Chapter 23- Algebra of Vectors
RD Chapter 23- Algebra of Vectors Ex-23.1
RD Chapter 23- Algebra of Vectors Ex-23.2
RD Chapter 23- Algebra of Vectors Ex-23.3
RD Chapter 23- Algebra of Vectors Ex-23.4
RD Chapter 23- Algebra of Vectors Ex-23.5
RD Chapter 23- Algebra of Vectors Ex-23.6
RD Chapter 23- Algebra of Vectors Ex-23.7
RD Chapter 23- Algebra of Vectors Ex-23.8
RD Chapter 23- Algebra of Vectors Ex-23.9
RD Chapter 24- Scalar Or Dot Product
RD Chapter 24- Scalar Or Dot Product Ex-24.1
RD Chapter 24- Scalar Or Dot Product Ex-24.2
RD Chapter 25- Vector or Cross Product
RD Chapter 25- Vector or Cross Product Ex-25.1
RD Chapter 26- Scalar Triple Product
RD Chapter 26- Scalar Triple Product Ex-26.1
RD Chapter 27- Direction Cosines and Direction Ratios
RD Chapter 27- Direction Cosines and Direction Ratios Ex-27.1
RD Chapter 28- Straight line in space
RD Chapter 28- Straight line in space Ex-28.1
RD Chapter 28- Straight line in space Ex-28.2
RD Chapter 28- Straight line in space Ex-28.3
RD Chapter 28- Straight line in space Ex-28.4
RD Chapter 28- Straight line in space Ex-28.5
RD Chapter 29- The plane
RD Chapter 29- The plane Ex-29.1
RD Chapter 29- The plane Ex-29.2
RD Chapter 29- The plane Ex-29.3
RD Chapter 29- The plane Ex-29.4
RD Chapter 29- The plane Ex-29.5
RD Chapter 29- The plane Ex-29.6
RD Chapter 29- The plane Ex-29.7
RD Chapter 29- The plane Ex-29.8
RD Chapter 29- The plane Ex-29.9
RD Chapter 29- The plane Ex-29.10
RD Chapter 29- The plane Ex-29.11
RD Chapter 29- The plane Ex-29.12
RD Chapter 29- The plane Ex-29.13
RD Chapter 29- The plane Ex-29.14
RD Chapter 29- The plane Ex-29.15
RD Chapter 30- Linear programming
RD Chapter 30- Linear programming Ex-30.1
RD Chapter 30- Linear programming Ex-30.2
RD Chapter 30- Linear programming Ex-30.3
RD Chapter 30- Linear programming Ex-30.4
RD Chapter 30- Linear programming Ex-30.5
RD Chapter 31- Probability
RD Chapter 31- Probability Ex-31.1
RD Chapter 31- Probability Ex-31.2
RD Chapter 31- Probability Ex-31.3
RD Chapter 31- Probability Ex-31.4
RD Chapter 31- Probability Ex-31.5
RD Chapter 31- Probability Ex-31.6
RD Chapter 31- Probability Ex-31.7
RD Chapter 32- Mean and variance of a random variable
RD Chapter 32- Mean and variance of a random variable Ex-32.1
RD Chapter 32- Mean and variance of a random variable Ex-32.2
RD Chapter 33- Binomial Distribution
RD Chapter 33- Binomial Distribution Ex-33.1
RD Chapter 33- Binomial Distribution Ex-33.2
NCERT Class 12 Sociology
NCERT Class 12 Sociology - Indian Society
Chapter 1 Introducing Indian Society
Chapter 2 The Demographic Structure of the Indian Society
Chapter 3 Social Institutions- Continuity and Change
Chapter 4 The Market as a Social Institution
Chapter 5 Patterns of Social Inequality and Exclusion
Chapter 6 The Challenges of Cultural Diversity
NCERT Class 12 Sociology - Social Change and Development in India
Chapter 1 Structural Change
Chapter 2 Cultural Change
Chapter 3 The Story of Indian Democracy
Chapter 4 Change and Development in Rural Society
Chapter 5 Change and Development in Industrial Society
Chapter 6 Globalisation and Social Change
Chapter 7 Mass Media and Communications
Chapter 8 Social Movements
NCERT Class 12 Psychology
Chapter 1 Intelligence And Aptitude
Chapter 2 Self And Personality
Chapter 3 Human Strengths And Meeting Life Challenges
Chapter 4 Psychological Disorders
Chapter 5 Therapeutic Approaches And Counselling
Chapter 6 Attitude And Social Cognition
Chapter 7 Social Influence And Group Processes
Chapter 8 Psychology And Life
Chapter 9 Developing Psychological Skills
NCERT Class 12 Accountancy
NCERT Class 12 Accountancy Part 1 Partnership Accounts
Chapter 1 - Accounting for Not-for-Profit Organisation
Chapter 2 - Accounting for Partnership - Basic Concepts
Chapter 3 - Reconstitution- Admission of a Partner
Chapter 4 - Reconstitution- Retirement-Death of a Partner
Chapter 5 - Dissolution of Partnership Firm
NCERT Class 12 Accountancy Part 2 Company Accounts and Analysis of Financial Statements
Chapter 1 - Accounting for Share Capital
Chapter 2 - Issue and Redemption of Debentures
Chapter 3 - Financial Statements of a Company
Chapter 4 - Analysis of Financial Statements
Chapter 5 - Accounting Ratios
Chapter 6 - Cash Flow Statement
NCERT Hindi Medium - Class 6
NCERT Hindi Medium - Class 6 विज्ञान (Science)
Chapter 1- दैनिक जीवन में विज्ञान
Chapter 2- पदार्थ एवें पदार्थ के समूह
Chapter 3- पदार्थों का पृथक्करण
Chapter 4- पास-पड़ोस में होने वाले परिवर्तन
Chapter 5- तन्तु से वस्त्र तक
Chapter 6- जीव जगत
Chapter 7- जीवों में अनुकूलन
Chapter 8- जन्तु की संरचना व कार्य
Chapter 9- भोजन एवं स्वास्थ्य
Chapter 10- स्वास्थ्य एवं स्वच्छता
Chapter 11- मापन
Chapter 12- गति
Chapter 13- ऊर्जा
Chapter 14- प्रकाश
Chapter 15- वायु
Chapter 16- जल
Chapter 17- कम्प्यूटर
NCERT Hindi Medium - Class 6 गणित (Maths)
Chapter 1- प्राकृतिक संख्याएँ
Chapter 1- प्राकृतिक संख्याएँ EX-1.1
Chapter 1- प्राकृतिक संख्याएँ EX-1.2
Chapter 2- पूर्ण संख्याएँ
Chapter 2- पूर्ण संख्याएँ Ex-2.1
Chapter 2- पूर्ण संख्याएँ Ex-2.2
Chapter 2- पूर्ण संख्याएँ Ex-2.3
Chapter 2- पूर्ण संख्याएँ Ex-2.4
Chapter 3- पूर्णांक
Chapter 3- पूर्णांक Ex-3.1
Chapter 3- पूर्णांक Ex-3.2
Chapter 3- पूर्णांक Ex-3.3
Chapter 3- पूर्णांक Ex-3.4
Chapter 3- पूर्णांक Ex-3.5
Chapter 3- पूर्णांक Ex-3.6
Chapter 4- सांख्यिकी
Chapter 4- सांख्यिकी Ex-4.1
Chapter 4- सांख्यिकी Ex-4.2
Chapter 4- सांख्यिकी Ex-4.3
Chapter 4- सांख्यिकी Ex-4.4
Chapter 4- सांख्यिकी Ex-4.5
Chapter 5- बीजगणितीय अवधारणा
Chapter 5- बीजगणितीय अवधारणा Ex-5-a
Chapter 5- बीजगणितीय अवधारणा Ex-5-b
Chapter 5- बीजगणितीय अवधारणा Ex-5-c
Chapter 5- बीजगणितीय अवधारणा Ex-5-d
Chapter 5- बीजगणितीय अवधारणा Ex-5-e
Chapter 6- बीजीय व्यंजक
Chapter 6- बीजीय व्यंजक Ex-6-a
Chapter 6- बीजीय व्यंजक Ex-6-b
Chapter 6- बीजीय व्यंजक Ex-6-c
Chapter 6- बीजीय व्यंजक Ex-6-d
Chapter 6- बीजीय व्यंजक Ex-6-e
Chapter 6- बीजीय व्यंजक Ex-6-f
Chapter 6- बीजीय व्यंजक Ex-6-g
Chapter 7- ज्यामितीय अवधारणाएँ
Chapter 7- ज्यामितीय अवधारणाएँ Ex-7-a
Chapter 7- ज्यामितीय अवधारणाएँ Ex-7-b
Chapter 7- ज्यामितीय अवधारणाएँ Ex-7-c
Chapter 8- कोण
Chapter 8- कोण Ex-8-a
Chapter 8- कोण Ex-8-b
Chapter 9- लम्ब और समान्तर रेखाएँ
Chapter 9- लम्ब और समान्तर रेखाएँ Ex-9-a
Chapter 9- लम्ब और समान्तर रेखाएँ Ex-9-b
Chapter 9- लम्ब और समान्तर रेखाएँ Ex-9-c
Chapter 9- लम्ब और समान्तर रेखाएँ Ex-9-d
Chapter 10- लघुत्तम समापवर्त्य एवं महत्तम समापवर्तक
Chapter 10- लघुत्तम समापवर्त्य एवं महत्तम समापवर्तक Ex-10-a
Chapter 10- लघुत्तम समापवर्त्य एवं महत्तम समापवर्तक Ex-10-b
Chapter 10- लघुत्तम समापवर्त्य एवं महत्तम समापवर्तक Ex-10-c
Chapter 10- लघुत्तम समापवर्त्य एवं महत्तम समापवर्तक Ex-10-d
Chapter 10- लघुत्तम समापवर्त्य एवं महत्तम समापवर्तक Ex-10-e
Chapter 10- लघुत्तम समापवर्त्य एवं महत्तम समापवर्तक Ex-10-f
Chapter 10- लघुत्तम समापवर्त्य एवं महत्तम समापवर्तक Ex-10-g
Chapter 11- समीकरण (एक चर में)
Chapter 11- समीकरण (एक चर में) Ex-11-a
Chapter 11- समीकरण (एक चर में) Ex-11-b
Chapter 12- वाणिज्य गणित
Chapter 12- वाणिज्य गणित Ex-12-a
Chapter 12- वाणिज्य गणित Ex-12-b
Chapter 12- वाणिज्य गणित Ex-12-c
Chapter 12- वाणिज्य गणित Ex-12-d
Chapter 12- वाणिज्य गणित Ex-12-e
Chapter 12- वाणिज्य गणित Ex-12-f
Chapter 12- वाणिज्य गणित Ex-12-g
Chapter 12- वाणिज्य गणित Ex-12-h
Chapter 12- वाणिज्य गणित Ex-12-i
Chapter 12- वाणिज्य गणित Ex-12-j
Chapter 12- वाणिज्य गणित Ex-12-k
Chapter 13- त्रिभुज
Chapter 13- त्रिभुज Ex-13-a
Chapter 13- त्रिभुज Ex-13-b
Chapter 13- त्रिभुज Ex-13-c
Chapter 13- त्रिभुज Ex-13-d
Chapter 13- त्रिभुज Ex-13-e
Chapter 13- त्रिभुज Ex-13-f
Chapter 13- त्रिभुज Ex-13-g
Chapter 14- वृत्त
Chapter 14- वृत्त Ex-14-a
Chapter 14- वृत्त Ex-14-b
Chapter 15- सममितता
Chapter 16- क्षेत्रमिति (मेन्सुरेशन)
Chapter 16- क्षेत्रमिति (मेन्सुरेशन) Ex-16-a
Chapter 16- क्षेत्रमिति (मेन्सुरेशन) Ex-16-b
NCERT Hindi Medium - Class 6 भूगोल (Geography)
Chapter 1- हमारा सौरमण्डल
Chapter 2- पृथ्वी और चन्द्रमा
Chapter 3- ग्लोब-अक्षांश एवं देशान्तर
Chapter 4- पृथ्वी की गतियाँ
Chapter 5- मानचित्रण
Chapter 6- पृथ्वी के परिमण्डल
Chapter 7- विश्व में भारत
Chapter 8- भारत का भौतिक स्वरूप
Chapter 9- भारत-जलवायु
Chapter 10- भारत-मृदा-वनस्पति एवं वन्य-जीव
Chapter 11- हमारा प्रदेश-उत्तर प्रदेश
NCERT Hindi Medium - Class 6 हिन्दी ( Hindi)
NCERT Hindi Medium - Class 6 English
NCERT Hindi Medium - Class 7
NCERT Hindi Medium - Class 7 विज्ञान (Science)
Chapter 1 मानव - विज्ञान और प्रौद्योगिकी
Chapter 2 रेशों से वस्त्र तक
Chapter 3 पदार्थ की संरचना एवं प्रकृति
Chapter 4 भौतिक एवं रासायनिक परिवर्तन
Chapter 5 ऊष्मा एवं ताप
Chapter 6 पौधों में पोषण
Chapter 7 जन्तुओं में पोषण
Chapter 8 जीवों में श्वसन
Chapter 9 जन्तुओं एवं पौधों में परिवहन
Chapter 10 जीवों में उत्सर्जन
Chapter 11 पौधों में जनन
Chapter 12 लाभदायक एवं हानिकारक पौधे तथा जन्तु
Chapter 13 भोजन स्वास्थ्य व रोग
Chapter 14 ध्वनि
Chapter 15 ऊर्जा
Chapter 16 प्रकाश
Chapter 17 बल एवं यंत्र
Chapter 18 स्थिर विद्युत
Chapter 19 जल
Chapter 20 वायु
Chapter 21 कम्प्यूटर
NCERT Hindi Medium - Class 7 सामाजिक विज्ञान - इतिहास
Chapter 1- हज़ार वर्षों के दौरान हुए परिवर्तनों की पड़ताल
Chapter 2- नए राजा और उनके राज्य
Chapter 3- दिल्ली के सुलतान
Chapter 4- मुग़ल साम्राज्य
Chapter 5- शासक और इमारतें
Chapter 6- नगर, व्यापारी और शिल्पिजन
Chapter 7- जनजातियाँ, खानाबदोश और एक जगह बसे हुए समुदाय
Chapter 8- ईश्वर से अनुराग
Chapter 9- क्षेत्रीय संस्कृतियों का निर्माण
Chapter 10- अठारहवीं शताब्दी में नए राजनीतिक गठन
NCERT Hindi Medium - Class 7 सामाजिक विज्ञान - भूगोल
Chapter 1- पर्यावरण
Chapter 2- हमारी पृथ्वी के अन्दर
Chapter 3- हमारी बदलती पृथ्वी
Chapter 4- वायु
Chapter 5- जल
Chapter 6- प्राकृतिक वनस्पति एवं वन्य जीवन
Chapter 7- मानविय पर्यावरण बस्तियाँ संचार- परिवहन एवं संचार
Chapter 8- मानव पर्यावरण अन्योन्यक्रिया
Chapter 9- शीतोष्ण घासस्थलों में जीवन
Chapter 10- रेगिस्तान में जीवन
NCERT Hindi Medium - Class 7 सामाजिक विज्ञान - नागरिक शास्त्र
Chapter 1- समानता
Chapter 2- स्वास्थ्य में सरकार की भूमिका
Chapter 3- राज्य शासन कैसे काम करता है
Chapter 4- लड़के और लड़कियों के रूप में बड़ा होना
Chapter 5- औरतों ने बदली दुनिया
Chapter 6- संचार माध्यमों को समझना
Chapter 7- विज्ञापनों को समझना
Chapter 8- हमारे आस-पास के बाज़ार
Chapter 9- बाज़ार में एक कमीज़
Chapter 10- समानता के लिए संघर्ष
NCERT Hindi Medium - Class 7 हिन्दी ( Hindi)
NCERT Hindi Medium - Class 7 English
NCERT Hindi Medium - Class 7 गणित (Maths)
Chapter 1 परिमेय संख्याएँ
Chapter 1 परिमेय संख्याएँ Ex 1-a
Chapter 1 परिमेय संख्याएँ Ex 1-b
Chapter 1 परिमेय संख्याएँ Ex 1-c
Chapter 1 परिमेय संख्याएँ Ex दक्षता -1
Chapter 2 घातांक
Chapter 2 घातांक Ex 2-a
Chapter 2 घातांक Ex 2-b
Chapter 2 घातांक Ex 2-c
Chapter 2 घातांक Ex 2-d
Chapter 2 घातांक Ex 2-e
Chapter 2 घातांक Ex दक्षता - 2
Chapter 3 साँख्यिकी
Chapter 3 साँख्यिकी Ex 3-a
Chapter 3 साँख्यिकी Ex 3-b
Chapter 3 साँख्यिकी Ex दक्षता -3
Chapter 4 रचनाएँ
Chapter 4 रचनाएँ Ex 4-a
Chapter 4 रचनाएँ Ex 4-b
Chapter 4 रचनाएँ Ex 4-c
Chapter 4 रचनाएँ Ex 4-d
Chapter 4 रचनाएँ Ex दक्षता -4
Chapter 5 त्रिभुज
Chapter 5 त्रिभुज Ex 5-a
Chapter 5 त्रिभुज Ex 5-b
Chapter 5 त्रिभुज Ex 5-c
Chapter 5 त्रिभुज Ex 5-d
Chapter 5 त्रिभुज Ex 5-e
Chapter 5 त्रिभुज Ex 5-f
Chapter 5 त्रिभुज Ex 5-g
Chapter 5 त्रिभुज Ex 5-h
Chapter 5 त्रिभुज Ex 5-i
Chapter 5 त्रिभुज Ex 5-j
Chapter 5 त्रिभुज Ex 5-k
Chapter 5 त्रिभुज Ex दक्षता -5
Chapter 6 रेखीय समीकरण
Chapter 6 रेखीय समीकरण Ex 6-a
Chapter 6 रेखीय समीकरण Ex 6-b
Chapter 6 रेखीय समीकरण Ex 6-c
Chapter 6 रेखीय समीकरण Ex 6-d
Chapter 6 रेखीय समीकरण Ex 6-e
Chapter 6 रेखीय समीकरण Ex 6-f
Chapter 6 रेखीय समीकरण Ex दक्षता -6
Chapter 7 वाणिज्य गणित
Chapter 7 वाणिज्य गणित Ex 7-a
Chapter 7 वाणिज्य गणित Ex 7-b
Chapter 7 वाणिज्य गणित Ex 7-c
Chapter 7 वाणिज्य गणित Ex 7-d
Chapter 7 वाणिज्य गणित Ex 7-e
Chapter 7 वाणिज्य गणित Ex 7-f
Chapter 7 वाणिज्य गणित Ex 7-g
Chapter 7 वाणिज्य गणित Ex 7-h
Chapter 7 वाणिज्य गणित Ex 7-i
Chapter 7 वाणिज्य गणित Ex दक्षता -7
Chapter 8 व्यंजकों का गुणनफल एवं सर्वसमिकाएँ
Chapter 8 व्यंजकों का गुणनफल एवं सर्वसमिकाएँ Ex 8-a
Chapter 8 व्यंजकों का गुणनफल एवं सर्वसमिकाएँ Ex 8-b
Chapter 8 व्यंजकों का गुणनफल एवं सर्वसमिकाएँ Ex 8-c
Chapter 8 व्यंजकों का गुणनफल एवं सर्वसमिकाएँ Ex 8-d
Chapter 8 व्यंजकों का गुणनफल एवं सर्वसमिकाएँ Ex 8-e
Chapter 8 व्यंजकों का गुणनफल एवं सर्वसमिकाएँ Ex 8-f
Chapter 8 व्यंजकों का गुणनफल एवं सर्वसमिकाएँ Ex 8-g
Chapter 8 व्यंजकों का गुणनफल एवं सर्वसमिकाएँ Ex 8-h
Chapter 8 व्यंजकों का गुणनफल एवं सर्वसमिकाएँ Ex दक्षता -8
Chapter 9 व्यंजकों का गुणनखण्ड
Chapter 9 व्यंजकों का गुणनखण्ड Ex 9-a
Chapter 9 व्यंजकों का गुणनखण्ड Ex 9-b
Chapter 9 व्यंजकों का गुणनखण्ड Ex दक्षता -9
Chapter 10 चतुर्भुज
Chapter 10 चतुर्भुज Ex 10-a
Chapter 10 चतुर्भुज Ex 10-b
Chapter 10 चतुर्भुज Ex 10-c
Chapter 10 चतुर्भुज Ex 10-d
Chapter 11 वृत्त
Chapter 11 वृत्त Ex 11-a
Chapter 11 वृत्त Ex 11-b
Chapter 11 वृत्त Ex 11-c
Chapter 11 वृत्त Ex दक्षता -11
Chapter 12 क्षेत्रमिति ( मेंसुरेशन)
Chapter 12 क्षेत्रमिति ( मेंसुरेशन) Ex 12-a
Chapter 12 क्षेत्रमिति ( मेंसुरेशन) Ex 12-b
Chapter 12 क्षेत्रमिति ( मेंसुरेशन) Ex 12-c
Chapter 12 क्षेत्रमिति ( मेंसुरेशन) Ex 12-d
Chapter 12 क्षेत्रमिति ( मेंसुरेशन) Ex 12-e
Chapter 12 क्षेत्रमिति ( मेंसुरेशन) Ex 12-f
Chapter 12 क्षेत्रमिति ( मेंसुरेशन) Ex 12-g
Chapter 12 क्षेत्रमिति ( मेंसुरेशन) Ex दक्षता -12
Chapter 13 मानसिक अभ्यास
NCERT Hindi Medium - Class 8
NCERT Hindi Medium - Class 8 विज्ञान (Science)
Chapter 1 -विज्ञान एवं तकनीकी के क्षेत्र में नवीनतम प्रगति
Chapter 2 -मानव निर्मित वस्तुएँ
Chapter 3 -परमाणु की संरचना
Chapter 4 -खनिज एवं धातु
Chapter 5 -सूक्ष्मजीवों का सामान्य परिचय एवं वर्गीकरण
Chapter 6 -कोशिका से अंग तंत्र तक
Chapter 7 -जन्तुओं में जनन
Chapter 8 -किशोरावस्था
Chapter 9 -दिव्यांगता
Chapter 10 -फसल उत्पादन
Chapter 11 -बल तथा दाब
Chapter 12 -प्रकाश एवं प्रकाश यंत्र
Chapter 13 -विद्युत धारा
Chapter 14 -चुम्बकत्व
Chapter 15 -कार्बन एवं उसके यौगिक
Chapter 16 -ऊर्जा के वैकल्पिक स्रोत
Chapter 17 -कम्प्यूटर
NCERT Hindi Medium - Class 8 सामाजिक विज्ञान - इतिहास
Chapter 1- कैसे- कब और कहाँ
Chapter 2- व्यापार से साम्राज्य तक कंपनी की सत्ता स्थापित होती है
Chapter 3- ग्रामीण क्षेत्र पर शासन चलाना
Chapter 4- आदिवासी- दीकु और एक स्वर्ण युग की कल्पना
Chapter 5- जब जनता बगावत करती है (1857 और उसके बाद)
Chapter 6- उपनिवेशवाद और शहर
Chapter 7- बुनकर- लोहा बनाने वाले और फैक्ट्री मालिक
Chapter 8- देशी जनता को सभ्य बनाना राष्ट्र को शिक्षित करना
Chapter 9- महिलाएँ- जाति एवं सुधार
Chapter 10- दृश्य कलाओं की बदलती दुनिया
Chapter 11- राष्ट्रीय आंदोलन का संघटन - 1870 के दशक से 1947 तक
Chapter 12- स्वतंत्रता के बाद
NCERT Hindi Medium - Class 8 सामाजिक विज्ञान - भूगोल
Chapter 1- संसाधन
Chapter 2- भूमि- मृदा- जल- प्राकृतिक वनस्पति और वन्य जीवन संसाधन
Chapter 3- खनिज और शक्ति संसाधन
Chapter 4- कृषि
Chapter 5- उद्योग
Chapter 6- मानव संसाधन
NCERT Hindi Medium - Class 8 सामाजिक विज्ञान - नागरिक शास्त्र
Chapter 1- भारतीय संविधान
Chapter 2- धर्मनिरपेक्षता की समझ
Chapter 3- हमें संसद क्यों चाहिए
Chapter 4- कानूनों की समझ
Chapter 5- न्यायपालिका
Chapter 6- हमारी आपराधिक न्याय प्रणाली
Chapter 7- हाशियाकरण की समझ
Chapter 8- हाशियाकरण से निपटना
Chapter 9- जन सुविधाएँ
Chapter 10- कानून और सामाजिक न्याय
NCERT Hindi Medium - Class 8 हिन्दी ( Hindi)
NCERT Hindi Medium - Class 8 English
NCERT Hindi Medium - Class 8 गणित (Maths)
Chapter 1 परिमेय संख्याओं पर संक्रियाएँ
Chapter 1 परिमेय संख्याओं पर संक्रियाएँ Ex 1-a
Chapter 1 परिमेय संख्याओं पर संक्रियाएँ Ex 1-b
Chapter 1 परिमेय संख्याओं पर संक्रियाएँ Ex 1-c
Chapter 1 परिमेय संख्याओं पर संक्रियाएँ Ex 1-d
Chapter 1 परिमेय संख्याओं पर संक्रियाएँ Ex 1-e
Chapter 1 परिमेय संख्याओं पर संक्रियाएँ Ex 1-f
Chapter 1 परिमेय संख्याओं पर संक्रियाएँ Ex 1-g
Chapter 1 परिमेय संख्याओं पर संक्रियाएँ Ex 1-h
Chapter 1 परिमेय संख्याओं पर संक्रियाएँ Ex 1-i
Chapter 1 परिमेय संख्याओं पर संक्रियाएँ Ex 1-j
Chapter 1 परिमेय संख्याओं पर संक्रियाएँ Ex 1-k
Chapter 1 परिमेय संख्याओं पर संक्रियाएँ Ex दक्षता -1
Chapter 2 वर्गमूल
Chapter 2 वर्गमूल Ex 2-a
Chapter 2 वर्गमूल Ex 2-b
Chapter 2 वर्गमूल Ex 2-c
Chapter 2 वर्गमूल Ex 2-d
Chapter 2 वर्गमूल Ex 2-e
Chapter 2 वर्गमूल Ex दक्षता -2
Chapter 3 घनमूल
Chapter 3 घनमूल Ex 3-a
Chapter 3 घनमूल Ex 3-b
Chapter 3 घनमूल Ex 3-c
Chapter 3 घनमूल Ex 3-d
Chapter 3 घनमूल Ex दक्षता -3
Chapter 4 सर्व समिकाएँ
Chapter 4 सर्व समिकाएँ Ex 4-a
Chapter 4 सर्व समिकाएँ Ex 4-b
Chapter 4 सर्व समिकाएँ Ex 4-c
Chapter 5 बीजीय व्यंजकों का भाग एवं गुणनखंड
Chapter 5 बीजीय व्यंजकों का भाग एवं गुणनखंड Ex 5-a
Chapter 5 बीजीय व्यंजकों का भाग एवं गुणनखंड Ex 5-b
Chapter 5 बीजीय व्यंजकों का भाग एवं गुणनखंड Ex 5-c
Chapter 5 बीजीय व्यंजकों का भाग एवं गुणनखंड Ex 5-d
Chapter 5 बीजीय व्यंजकों का भाग एवं गुणनखंड Ex 5-e
Chapter 5 बीजीय व्यंजकों का भाग एवं गुणनखंड Ex 5-f
Chapter 5 बीजीय व्यंजकों का भाग एवं गुणनखंड Ex दक्षता -5
Chapter 6 संख्याओं से खेल
Chapter 6 संख्याओं से खेल Ex 6-a
Chapter 7 युगपत समीकरण
Chapter 7 युगपत समीकरण Ex 7-a
Chapter 7 युगपत समीकरण Ex 7-b
Chapter 7 युगपत समीकरण Ex 7-c
Chapter 7 युगपत समीकरण Ex 7-d
Chapter 7 युगपत समीकरण Ex 7-e
Chapter 7 युगपत समीकरण Ex दक्षता -7
Chapter 8 वर्ग समीकरण
Chapter 8 वर्ग समीकरण Ex 8-a
Chapter 8 वर्ग समीकरण Ex 8-b
Chapter 8 वर्ग समीकरण Ex 8-c
Chapter 8 वर्ग समीकरण Ex दक्षता -8
Chapter 9 समान्तर रेखाएँ
Chapter 9 समान्तर रेखाएँ Ex 9-a
Chapter 9 समान्तर रेखाएँ Ex 9-b
Chapter 9 समान्तर रेखाएँ Ex 9-c
Chapter 10 चतुर्भुज की रचनाएँ
Chapter 10 चतुर्भुज की रचनाएँ Ex 10-a
Chapter 10 चतुर्भुज की रचनाएँ Ex 10-b
Chapter 10 चतुर्भुज की रचनाएँ Ex 10-c
Chapter 10 चतुर्भुज की रचनाएँ Ex 10-d
Chapter 10 चतुर्भुज की रचनाएँ Ex 10-e
Chapter 10 चतुर्भुज की रचनाएँ Ex 10-f
Chapter 10 चतुर्भुज की रचनाएँ Ex दक्षता -10
Chapter 11 वाणिज्य गणित
Chapter 11 वाणिज्य गणित Ex 11-a
Chapter 11 वाणिज्य गणित Ex 11-b
Chapter 11 वाणिज्य गणित Ex दक्षता -11
Chapter 12 बैंकिंग
Chapter 12 बैंकिंग Ex 12-a
Chapter 13 वृत्त और चक्रीय चतुर्भज
Chapter 13 वृत्त और चक्रीय चतुर्भज Ex 13-a
Chapter 13 वृत्त और चक्रीय चतुर्भज Ex 13-b
Chapter 13 वृत्त और चक्रीय चतुर्भज Ex 13-c
Chapter 13 वृत्त और चक्रीय चतुर्भज Ex 13-d
Chapter 13 वृत्त और चक्रीय चतुर्भज Ex दक्षता-13
Chapter 14 वृत्त की स्पर्श रेखाएँ
Chapter 14 वृत्त की स्पर्श रेखाएँ Ex 14-a
Chapter 14 वृत्त की स्पर्श रेखाएँ Ex 14-b
Chapter 14 वृत्त की स्पर्श रेखाएँ Ex 14-c
Chapter 14 वृत्त की स्पर्श रेखाएँ Ex दक्षता-14
Chapter 15 सॉख्यिकी
Chapter 15 सॉख्यिकी Ex 15-a
Chapter 15 सॉख्यिकी Ex 15-b
Chapter 15 सॉख्यिकी Ex 15-c
Chapter 15 सॉख्यिकी Ex 15-d
Chapter 15 सॉख्यिकी Ex दक्षता-15
Chapter 16 संभावना (प्रायिकता)
Chapter 16 संभावना (प्रायिकता) Ex 16-a
Chapter 16 संभावना (प्रायिकता) Ex 16-b
Chapter 17 कार्तीय तल
Chapter 17 कार्तीय तल Ex 17-a
Chapter 17 कार्तीय तल Ex 17-b
Chapter 18 क्षेत्रमिति (मेंसुरेशन)
Chapter 18 क्षेत्रमिति (मेंसुरेशन) Ex 18-a
Chapter 18 क्षेत्रमिति (मेंसुरेशन) Ex 18-b
Chapter 18 क्षेत्रमिति (मेंसुरेशन) Ex 18-c
Chapter 18 क्षेत्रमिति (मेंसुरेशन) Ex 18-d
Chapter 18 क्षेत्रमिति (मेंसुरेशन) Ex 18-e
Chapter 18 क्षेत्रमिति (मेंसुरेशन) Ex दक्षता-18
NCERT Hindi Medium - Class 9
NCERT Hindi Medium - Class 9 विज्ञान (Science)
Chapter 1- हमारे आस-पास के पदार्थ
Chapter 2- क्या हमारे आस-पास के पदार्थ शुद्ध हैं
Chapter 3- परमाणु एवं अणु
Chapter 4- परमाणु की संरचना
Chapter 5- जीवन की मौलिक इकाई
Chapter 6- ऊतक
Chapter 7- जीवों में विविधता
Chapter 8- गति
Chapter 9- बल तथा गति के नियम
Chapter 10- गुरुत्वाकर्षण
Chapter 11- कार्य-शक्ति और ऊर्जा
Chapter 12- ध्वनि
Chapter 13- हम बिमार क्यों होते हैं।
Chapter 14- प्राकृतिक संपदा
Chapter 15- खाद्य संसाधनों में सुधार
NCERT Hindi Medium - Class 9 सामाजिक विज्ञान
NCERT Hindi Medium - Class 9 सामाजिक विज्ञान- इतिहास
Chapter 1- फ्रांसीसी क्रान्ति
Chapter 2- यूरोप में समाजवाद एवं रूसी क्रान्ति
Chapter 3- नात्सीवाद और हिटलर का उदय
Chapter 4- वन्य-समाज और उपनिवेशवाद
Chapter 5- आधुनिक विश्व में चरवाहे
Chapter 6- किसान और काश्तकार
Chapter 7- इतिहास और खेल - क्रिकेट की कहानी
Chapter 8- पहनावे का सामाजिक इतिहास
NCERT Hindi Medium - Class 9 सामाजिक विज्ञान- भूगोल
Chapter 1- भारत-आकार एवं स्थिति
Chapter 2- भारत का भौतिक स्वरूप
Chapter 3- अपवाह
Chapter 4- जलवायु
Chapter 5- प्राकृतिक वनस्पति तथा वन्य प्राणी
Chapter 6- जनसंख्या
NCERT Hindi Medium - Class 9 सामाजिक विज्ञान- नागरिकशास्त्र
Chapter 1- समकालीन विश्व में
Chapter 2- लोकतन्त्र क्या-लोकतंत्र क्यों
Chapter 3- संविधान निर्माण
Chapter 4- चुनावी राजनीति
Chapter 5- संस्थाओं का कामकाज
Chapter 6- लोकतांत्रिक अधिकार
NCERT Hindi Medium - Class 9 सामाजिक विज्ञान- अर्थशास्त्र
Chapter 1- पालमपुर गाँव की कहानी
Chapter 2- संसाधन के रूप में लोग
Chapter 3- निर्धनता-एक चुनौती
Chapter 4- भारत में खाद्य सुरक्षा
NCERT Hindi Medium - Class 9 गणित (Maths)
Chapter 1- संख्या पद्धति (Number Systems)
Chapter 1- संख्या पद्धति (Number Systems) Ex-1.1
Chapter 1- संख्या पद्धति (Number Systems) Ex-1.2
Chapter 1- संख्या पद्धति (Number Systems) Ex-1.3
Chapter 1- संख्या पद्धति (Number Systems) Ex-1.4
Chapter 1- संख्या पद्धति (Number Systems) Ex-1.5
Chapter 1- संख्या पद्धति (Number Systems) Ex-1.6
Chapter 2- बहुपद (Poly)
Chapter 2- बहुपद (Poly) Ex-2.1
Chapter 2- बहुपद (Poly) Ex-2.2
Chapter 2- बहुपद (Poly) Ex-2.3
Chapter 2- बहुपद (Poly) Ex-2.4
Chapter 2- बहुपद (Poly) Ex-2.5
Chapter 3- निर्देशांक ज्यामिति (Coordinate Geometry)
Chapter 3- निर्देशांक ज्यामिति (Coordinate Geometry) Ex-3.1
Chapter 3- निर्देशांक ज्यामिति (Coordinate Geometry) Ex-3.2
Chapter 3- निर्देशांक ज्यामिति (Coordinate Geometry) Ex-3.3
Chapter 4- दो चरों में रैखिक समीकरण (Linear Equations in Two Variables)
Chapter 4- दो चरों में रैखिक समीकरण (Linear Equations in Two Variables) Ex-4.1
Chapter 4- दो चरों में रैखिक समीकरण (Linear Equations in Two Variables) Ex-4.2
Chapter 4- दो चरों में रैखिक समीकरण (Linear Equations in Two Variables) Ex-4.3
Chapter 4- दो चरों में रैखिक समीकरण (Linear Equations in Two Variables) Ex-4.4
Chapter 5- युक्लिड के ज्यामिति का परिचय (Introduction to Euclid’s Geometry)
Chapter 5- युक्लिड के ज्यामिति का परिचय (Introduction to Euclid’s Geometry) Ex-5.1
Chapter 5- युक्लिड के ज्यामिति का परिचय (Introduction to Euclid’s Geometry) Ex-5.2
Chapter 6- रेखाएँ और कोण (Lines and Angles)
Chapter 6- रेखाएँ और कोण (Lines and Angles) Ex-6.1
Chapter 6- रेखाएँ और कोण (Lines and Angles) Ex-6.2
Chapter 6- रेखाएँ और कोण (Lines and Angles) Ex-6.3
Chapter 7- त्रिभुज (Triangles)
Chapter 7- त्रिभुज (Triangles) Ex-7.1
Chapter 7- त्रिभुज (Triangles) Ex-7.2
Chapter 7- त्रिभुज (Triangles) Ex-7.3
Chapter 7- त्रिभुज (Triangles) Ex-7.4
Chapter 7- त्रिभुज (Triangles) Ex-7.5
Chapter 8- चतुर्भुज (Quadrilaterals)
Chapter 8- चतुर्भुज (Quadrilaterals) Ex-8.1
Chapter 8- चतुर्भुज (Quadrilaterals) Ex-8.2
Chapter 9- समान्तर चतुर्भुज और त्रिभुजों के क्षेत्रफल
Chapter 9- समान्तर चतुर्भुज और त्रिभुजों के क्षेत्रफल Ex-9.1
Chapter 9- समान्तर चतुर्भुज और त्रिभुजों के क्षेत्रफल Ex-9.2
Chapter 9- समान्तर चतुर्भुज और त्रिभुजों के क्षेत्रफल Ex-9.3
Chapter 9- समान्तर चतुर्भुज और त्रिभुजों के क्षेत्रफल Ex-9.4
Chapter 10- वृत्त (Circles -)
Chapter 10- वृत्त (Circles -) Ex-10.1
Chapter 10- वृत्त (Circles -) Ex-10.2
Chapter 10- वृत्त (Circles -) Ex-10.3
Chapter 10- वृत्त (Circles -) Ex-10.4
Chapter 10- वृत्त (Circles -) Ex-10.5
Chapter 10- वृत्त (Circles -) Ex-10.6
Chapter 11- रचनाएँ (Constructions-)
Chapter 11- रचनाएँ (Constructions-) Ex-11.1
Chapter 11- रचनाएँ (Constructions-) Ex-11.2
Chapter 12- हीरोन सूत्र (Heron’s Formula)
Chapter 12- हीरोन सूत्र (Heron’s Formula) Ex-12.1
Chapter 12- हीरोन सूत्र (Heron’s Formula) Ex-12.2
Chapter 13- पृष्ठीय क्षेत्रफल एवं आयतन (Surface Areas-Volumes)
Chapter 13- पृष्ठीय क्षेत्रफल एवं आयतन (Surface Areas-Volumes) Ex-13.1
Chapter 13- पृष्ठीय क्षेत्रफल एवं आयतन (Surface Areas-Volumes) Ex-13.2
Chapter 13- पृष्ठीय क्षेत्रफल एवं आयतन (Surface Areas-Volumes) Ex-13.3
Chapter 13- पृष्ठीय क्षेत्रफल एवं आयतन (Surface Areas-Volumes) Ex-13.4
Chapter 13- पृष्ठीय क्षेत्रफल एवं आयतन (Surface Areas-Volumes) Ex-13.5
Chapter 13- पृष्ठीय क्षेत्रफल एवं आयतन (Surface Areas-Volumes) Ex-13.6
Chapter 13- पृष्ठीय क्षेत्रफल एवं आयतन (Surface Areas-Volumes) Ex-13.7
Chapter 13- पृष्ठीय क्षेत्रफल एवं आयतन (Surface Areas-Volumes) Ex-13.8
Chapter 13- पृष्ठीय क्षेत्रफल एवं आयतन (Surface Areas-Volumes) Ex-13.9
Chapter 14- सांख्यिकी (Statistics -)
Chapter 14- सांख्यिकी (Statistics -) Ex-14.1
Chapter 14- सांख्यिकी (Statistics -) Ex-14.2
Chapter 14- सांख्यिकी (Statistics -) Ex-14.3
Chapter 14- सांख्यिकी (Statistics -) Ex-14.4
Chapter 15- प्रायिकता (Probability -)
NCERT Hindi Medium - Class 9 हिन्दी ( Hindi)
NCERT Hindi Medium - Class 9 English
NCERT Hindi Medium - Class 10
NCERT Hindi Medium - Class 10- विज्ञान (Science)
Chapter 1- रासायनिक अभिक्रियाएँ और समीकरण (Chemical Reactions and Equations)
Chapter 2- अम्ल, क्षार एवं लवण (Acids, Bases and Salts)
Chapter 3- धातु और अधातु (Metals and Non-metals)
Chapter 4- कार्बन और इसके यौगिक (Carbon and Its Compounds)
Chapter 5- तत्वों के आवर्त वर्गीकरण (Periodic Classification of Elements)
Chapter 6- जैव-प्रक्रम (Life Processes)
Chapter 7- नियंत्रण एवं समन्वय (Control and Coordination)
Chapter 8- जीव जनन कैसे करते है (How do Organisms Reproduce)
Chapter 9- अनुवांशिकता एवं जैव विकास (Heredity and Evolution)
Chapter 10- प्रकाश-परावर्तन एवं अपवर्तन (Light Reflection and Refraction)
Chapter 11- मानव-नेत्र एवं रंगबिरंगी दुनियाँ (Human Eye and Colourful World)
Chapter 12- विद्युत (Electricity)
Chapter 13- विद्युत धारा का चुम्बकीय प्रभाव (Magnetic Effects of Electric Current)
Chapter 14- उर्जा के स्रोत (Sources of Energy)
Chapter 15- हमारा पर्यावरण (Our Environment)
Chapter 16- प्राकृतिक संसाधनों का प्रबंधन (Management of Natural Resources)
NCERT Hindi Medium - Class 10- गणित (Maths)
Chapter 1- वास्तविक संख्याएँ (Real Numbers)
Chapter 1- वास्तविक संख्याएँ (Real Numbers) Ex-1.1
Chapter 1- वास्तविक संख्याएँ (Real Numbers) Ex-1.2
Chapter 1- वास्तविक संख्याएँ (Real Numbers) Ex-1.3
Chapter 1- वास्तविक संख्याएँ (Real Numbers) Ex-1.4
Chapter 2- बहुपद -(Polynomials)
Chapter 2- बहुपद (Polynomials) Ex-2.1
Chapter 2- बहुपद (Polynomials) Ex-2.2
Chapter 2- बहुपद (Polynomials) Ex-2.3
Chapter 2- बहुपद (Polynomials) Ex-2.4
Chapter 3- दो चरों वाले रखिक समीकरणों का युग्म
Chapter 3- दो चरों वाले रखिक समीकरणों का युग्म Ex-3.1
Chapter 3- दो चरों वाले रखिक समीकरणों का युग्म Ex-3.2
Chapter 3- दो चरों वाले रखिक समीकरणों का युग्म Ex-3.3
Chapter 3- दो चरों वाले रखिक समीकरणों का युग्म Ex-3.4
Chapter 3- दो चरों वाले रखिक समीकरणों का युग्म Ex-3.5
Chapter 3- दो चरों वाले रखिक समीकरणों का युग्म Ex-3.6
Chapter 3- दो चरों वाले रखिक समीकरणों का युग्म Ex-3.7
Chapter 4- द्विघात समीकरण (Quadratic Equations)
Chapter 4- द्विघात समीकरण (Quadratic Equations) Ex-4.1
Chapter 4- द्विघात समीकरण (Quadratic Equations) Ex-4.2
Chapter 4- द्विघात समीकरण (Quadratic Equations) Ex-4.3
Chapter 4- द्विघात समीकरण (Quadratic Equations) Ex-4.4
Chapter 5- समान्तर श्रेढ़ी (Arithmetic Progressions)
Chapter 5- समान्तर श्रेढ़ी (Arithmetic Progressions) Ex-5.1
Chapter 5- समान्तर श्रेढ़ी (Arithmetic Progressions) Ex-5.2
Chapter 5- समान्तर श्रेढ़ी (Arithmetic Progressions) Ex-5.3
Chapter 5- समान्तर श्रेढ़ी (Arithmetic Progressions) Ex-5.4
Chapter 6- त्रिभुज (Triangles)
Chapter 6- त्रिभुज (Triangles) Ex-6.1
Chapter 6- त्रिभुज (Triangles) Ex-6.2
Chapter 6- त्रिभुज (Triangles) Ex-6.3
Chapter 6- त्रिभुज (Triangles) Ex-6.4
Chapter 6- त्रिभुज (Triangles) Ex-6.5
Chapter 6- त्रिभुज (Triangles) Ex-6.6
Chapter 7- निर्देशांक ज्यामिति (Coordinate Geometry)
Chapter 7- निर्देशांक ज्यामिति (Coordinate Geometry) Ex-7.1
Chapter 7- निर्देशांक ज्यामिति (Coordinate Geometry) Ex-7.2
Chapter 7- निर्देशांक ज्यामिति (Coordinate Geometry) Ex-7.3
Chapter 7- निर्देशांक ज्यामिति (Coordinate Geometry) Ex-7.4
Chapter 8- त्रिकोणमिति का परिचय (Introduction to Trigonometry)
Chapter 8- त्रिकोणमिति का परिचय (Introduction to Trigonometry) Ex-8.1
Chapter 8- त्रिकोणमिति का परिचय (Introduction to Trigonometry) Ex-8.2
Chapter 8- त्रिकोणमिति का परिचय (Introduction to Trigonometry) Ex-8.3
Chapter 8- त्रिकोणमिति का परिचय (Introduction to Trigonometry) Ex-8.4
Chapter 9- त्रिकोणमिति का अनुप्रयोग (Some Applications of Trigonometry)
Chapter 9- त्रिकोणमिति का अनुप्रयोग (Some Applications of Trigonometry) Ex-9.1
Chapter 10- वृत्त (Circles)
Chapter 10- वृत्त (Circles) Ex-10.1
Chapter 10- वृत्त (Circles) Ex-10.2
Chapter 11- रचनाएँ (Constructions)
Chapter 11- रचनाएँ (Constructions) Ex-11.1
Chapter 11- रचनाएँ (Constructions) Ex-11.2
Chapter 12- वृतों से सम्बंधित क्षेत्रफल (Areas Related to Circles)
Chapter 12- वृतों से सम्बंधित क्षेत्रफल (Areas Related to Circles) Ex-12.1
Chapter 12- वृतों से सम्बंधित क्षेत्रफल (Areas Related to Circles) Ex-12.2
Chapter 12- वृतों से सम्बंधित क्षेत्रफल (Areas Related to Circles) Ex-12.3
Chapter 13- पृष्ठीय क्षेत्रफल एवं आयतन (Surface Areas and Volumes)
Chapter 13- पृष्ठीय क्षेत्रफल एवं आयतन (Surface Areas and Volumes) Ex-13.1
Chapter 13- पृष्ठीय क्षेत्रफल एवं आयतन (Surface Areas and Volumes) Ex-13.2
Chapter 13- पृष्ठीय क्षेत्रफल एवं आयतन (Surface Areas and Volumes) Ex-13.3
Chapter 13- पृष्ठीय क्षेत्रफल एवं आयतन (Surface Areas and Volumes) Ex-13.4
Chapter 13- पृष्ठीय क्षेत्रफल एवं आयतन (Surface Areas and Volumes) Ex-13.5
Chapter 14- सांख्यिकी (Statistics)
Chapter 14- सांख्यिकी (Statistics) Ex-14.1
Chapter 14- सांख्यिकी (Statistics) Ex-14.2
Chapter 14- सांख्यिकी (Statistics) Ex-14.3
Chapter 14- सांख्यिकी (Statistics) Ex-14.4
Chapter 15- प्रायिकता (Probability)
Chapter 15- प्रायिकता (Probability) Ex-15.1
Chapter 15- प्रायिकता (Probability) Ex-15.2
NCERT Hindi Medium - Class 10- English
NCERT Hindi Medium - Class 10- English - Footprints
Chapter 1- The Enchanted Pool (C. Rajagopalachari)
Chapter 2- A Letter to God (G.L. Fuentes)
Chapter 3- The Ganga (Jawaharlal Nehru)
Chapter 4- Socrates (Rhoda Power) [Adapted]
Chapter 5- Torch Bearers (W.M. Ryburn)
Chapter 6- Our Indian Music - Stories and Anecdotes (R. Srinivasan)
NCERT Hindi Medium - Class 10- English - First Flight
Chapter 1- The Fountain (James Russell Lowell)
Chapter 2- The Psalm of Life (H. W. Longfellow)
Chapter 3- The Village Song (Sarojini Naidu)
Chapter 4- The Nation Builders (Ralph Waldo Emerson)
NCERT Hindi Medium - Class 10- English- SUPPLEMENTARY READER
Chapter 1- The Inventor Who Kept His Promise
Chapter 2- The Judgement-Seat of Vikramaditya (Sister Nivedita)
Chapter 3- My Greatest Olympic Prize (Jesse Owens)
NCERT Hindi Medium - Class 10 सामाजिक विज्ञान
NCERT Hindi Medium - Class 10 सामाजिक विज्ञान - इतिहास (भारत और समकालीन विश्व - II)
Chapter 1- यूरोप में राष्ट्रवाद का उदय
Chapter 2- इंडो-चाइना में राष्ट्रवादी आंदोलन
Chapter 3- भारत में राष्ट्रवाद
Chapter 4- भूमंडलीकृत विश्व का बनना
Chapter 5- औद्योगीकरण का युग
Chapter 6- काम-आराम और जीवन
Chapter 7- मुद्रण संस्कृति और आधुनिक दुनिया
Chapter 8- उपन्यास-समाज और इतिहास
NCERT Hindi Medium - Class 10 सामाजिक विज्ञान - राजनीति विज्ञान (लोकतांत्रिक राजनीति)
Chapter 1- सत्ता की साझेदारी
Chapter 2- संघवाद
Chapter 3- लोकतंत्र और विविधता
Chapter 4- जाति, धर्म और लैंगिक मसले
Chapter 5- जन-संघर्ष और आंदोलन
Chapter 6- राजनीतिक दल
Chapter 7- लोकतंत्र के परिणाम
Chapter 8- लोकतंत्र की चुनौतियाँ
NCERT Hindi Medium - Class 10 सामाजिक विज्ञान - अर्थशास्त्र (आर्थिक विकास को समझना)
Chapter 1- विकास
Chapter 2- भारतीय अर्थव्यवस्था के क्षेत्रक
Chapter 3- मुद्रा और साख
Chapter 4- वैश्वीकरण और भारतीय अर्थव्यवस्था
Chapter 5- उपभोक्ता अधिकार
NCERT Hindi Medium - Class 10 हिन्दी ( Hindi)
NCERT Hindi Medium - Class 10- हिन्दी - क्षितिज भाग 2 (Kshitij Bhag 2)
NCERT Hindi Medium - Class 10- हिन्दी - स्पर्श भाग 2 (Sparsh Bhag 2)
NCERT Hindi Medium - Class 11
NCERT Hindi Medium - Class 11 भौतिक विज्ञान (Physics)
Chapter 1- भौतिक जगत (Physical World)
Chapter 2- मात्रक एवं मापन (Units and Measurements)
Chapter 3- सरल रेखा में गति (Motion in a Straight Line)
Chapter 4- समतल में गति (Motion in a plane)
Chapter 5- गति के नियम (Laws of Motion)
Chapter 6- कार्य, ऊर्जा और शक्ति (Work Energy and Power)
Chapter 7- कणों के निकाय तथा घूर्णी गति (System of particles and Rotational Motion)
Chapter 8- गुरुत्वाकर्षण (Gravitation)
Chapter 9- ठोसों के यान्त्रिक गुण (Mechanical Properties of Solids)
Chapter 10- तरलों के यान्त्रिक गुण (Mechanical Properties of Fluids)
Chapter 11- द्रव्य के तापीय गुण (Thermal Properties of Matter)
Chapter 12- ऊष्मागतिकी (Thermodynamics)
Chapter 13- अणुगति सिद्धान्त (Kinetic Theory)
Chapter 14- दोलन (Oscillations)
Chapter 15- तरंगें (Waves)
NCERT Hindi Medium - Class 11 रसायन विज्ञान (Chemistry)
Chapter 1- रसायन विज्ञान की कुछ मूल अवधारणाएँ (Some Basic Concepts of Chemistry)
Chapter 2- परमाणु की संरचना (Structure of Atom)
Chapter 3- तत्त्वों का वर्गीकरण एवं गुणधर्मों में आवर्तिता (Classification of Elements and Periodici
Chapter 4- रासायनिक आबन्धन एवं आण्विक संरचना (Chemical Bonding and Molecular Structure)
Chapter 5- द्रव्य की अवस्थाएँ (States of Matter)
Chapter 6- ऊष्मागतिकी (Thermodynamics)
Chapter 7- साम्यावस्था (Equilibrium)
Chapter 8- अपचयोपचय अभिक्रियाएँ (Redox Reactions)
Chapter 9- हाइड्रोजन (Hydrogen)
Chapter 10- s-ब्लॉक तत्त्व (The s-block Elements)
Chapter 11- p-ब्लॉक के तत्त्व (The p-block Elements)
Chapter 12- कार्बनिक रसायन - कुछ आधारभूत सिद्धान्त तथा तकनीकें (Organic Chemistry - Some Basic Princ
Chapter 13- हाइड्रोकार्बन (Hydrocarbons)
Chapter 14- पर्यावरणीय रसायन (Environment Chemistry)
NCERT Hindi Medium - Class 11 जीव विज्ञान (Biology)
Chapter 1- जीव जगत (The Living World)
Chapter 2- जीव जगत का वर्गीकरण (Biological Classification)
Chapter 3- वनस्पति जगत (Plant Kingdom)
Chapter 4- प्राणि जगत (Animal Kingdom)
Chapter 5- पुष्पी पादपों की आकारिकी (Morphology of Flowering Plants)
Chapter 6- पुष्पी पादपों का शारीर (Anatomy of Flowering Plants)
Chapter 7- प्राणियों में संरचनात्मक संगठन (Structural Organisation in Animals)
Chapter 8- कोशिका - जीवन की इकाई (Cell The Unit of Life)
Chapter 9- जैव अणु (Biomolecules)
Chapter 10- कोशिका चक्र और कोशिका विभाजन (Cell Cycle and Cell Division)
Chapter 11- पौधों में परिवहन (Transport in Plants)
Chapter 12- खनिज पोषण (Mineral Nutrition)
Chapter 13- उच्च पादपों में प्रकाश-संश्लेषण (Photosynthesis in Higher Plants)
Chapter 14- पादप में श्वसन (Respiration in Plants)
Chapter 15- पादप वृद्धि एवं परिवर्धन (Plant Growth and Development)
Chapter 16- पाचन एवं अवशोषण (Digestion and Absorption)
Chapter 17- श्वसन और गैसों का विनिमय (Breathing and Exchange of Gases)
Chapter 18- शरीर द्रव तथा परिसंचरण (Body Fluids and Circulation)
Chapter 19- उत्सर्जी उत्पाद एवं उनका निष्कासन (Excretory Products and their Elimination)
Chapter 20- गमन एवं संचलन (Locomotion and Movement)
Chapter 21- तन्त्रिकीय नियन्त्रण एवं समन्वय (Neural Control and Coordination)
Chapter 22- रासायनिक समन्वय तथा एकीकरण (Chemical Coordination and Integration)
NCERT Hindi Medium - Class 11 गणित (Maths)
Chapter 1- समुच्चय (Sets)
Chapter 1- समुच्चय (Sets) Ex-1.1
Chapter 1- समुच्चय (Sets) Ex-1.2
Chapter 1- समुच्चय (Sets) Ex-1.3
Chapter 1- समुच्चय (Sets) Ex-1.4
Chapter 1- समुच्चय (Sets) Ex-1.5
Chapter 1- समुच्चय (Sets) Ex-1.6
Chapter 2- संबंध एवं फलन (Relations and Functions)
Chapter 2- संबंध एवं फलन (Relations and Functions) Ex-2.1
Chapter 2- संबंध एवं फलन (Relations and Functions) Ex-2.2
Chapter 2- संबंध एवं फलन (Relations and Functions) Ex-2.3
Chapter 3- त्रिकोणमितीय फलन (Trigonometric Functions)
Chapter 3- त्रिकोणमितीय फलन (Trigonometric Functions) Ex-3.1
Chapter 3- त्रिकोणमितीय फलन (Trigonometric Functions) Ex-3.2
Chapter 3- त्रिकोणमितीय फलन (Trigonometric Functions) Ex-3.3
Chapter 3- त्रिकोणमितीय फलन (Trigonometric Functions) Ex-3.4
Chapter 4- गणितीय आगमन का सिद्धान्त (Principle of Mathematical Induction)
Chapter 4- गणितीय आगमन का सिद्धान्त (Principle of Mathematical Induction) Ex-4.1
Chapter 5- सम्मिश्र संख्याएँ और द्विघातीय समीकरण
Chapter 5- सम्मिश्र संख्याएँ और द्विघातीय समीकरण Ex-5.1
Chapter 5- सम्मिश्र संख्याएँ और द्विघातीय समीकरण Ex-5.2
Chapter 5- सम्मिश्र संख्याएँ और द्विघातीय समीकरण Ex-5.3
Chapter 6- रैखिक असमिकाएँ (Linear Inequalities)
Chapter 6- रैखिक असमिकाएँ (Linear Inequalities) Ex-6.1
Chapter 6- रैखिक असमिकाएँ (Linear Inequalities) Ex-6.2
Chapter 6- रैखिक असमिकाएँ (Linear Inequalities) Ex-6.3
Chapter 7- क्रमचय और संचयं (Permutations and Combinations)
Chapter 7- क्रमचय और संचयं (Permutations and Combinations) Ex-7.1
Chapter 7- क्रमचय और संचयं (Permutations and Combinations) Ex-7.2
Chapter 7- क्रमचय और संचयं (Permutations and Combinations) Ex-7.3
Chapter 7- क्रमचय और संचयं (Permutations and Combinations) Ex-7.4
Chapter 8- द्विपद प्रमेय (Binomial Theorem)
Chapter 8- द्विपद प्रमेय (Binomial Theorem) Ex-8.1
Chapter 8- द्विपद प्रमेय (Binomial Theorem) Ex-8.2
Chapter 9- अनुक्रम तथा श्रेणी (Sequences and Series)
Chapter 9- अनुक्रम तथा श्रेणी (Sequences and Series) Ex-9.1
Chapter 9- अनुक्रम तथा श्रेणी (Sequences and Series) Ex-9.2
Chapter 9- अनुक्रम तथा श्रेणी (Sequences and Series) Ex-9.3
Chapter 9- अनुक्रम तथा श्रेणी (Sequences and Series) Ex-9.4
Chapter 10- सरल रेखाएँ (Straight Lines)
Chapter 10- सरल रेखाएँ (Straight Lines) Ex-10.1
Chapter 10- सरल रेखाएँ (Straight Lines) Ex-10.2
Chapter 10- सरल रेखाएँ (Straight Lines) Ex-10.3
Chapter 11- शंकु परिच्छेद (Conic Sections)
Chapter 11- शंकु परिच्छेद (Conic Sections) Ex-11.1
Chapter 11- शंकु परिच्छेद (Conic Sections) Ex-11.2
Chapter 11- शंकु परिच्छेद (Conic Sections) Ex-11.3
Chapter 11- शंकु परिच्छेद (Conic Sections) Ex-11.4
Chapter 12- त्रिविमीय ज्यामिति का परिचय (Introduction to three Dimensional Geometry)
Chapter 12- त्रिविमीय ज्यामिति का परिचय (Introduction to three Dimensional Geometry) Ex-12.1
Chapter 12- त्रिविमीय ज्यामिति का परिचय (Introduction to three Dimensional Geometry) Ex-12.2
Chapter 12- त्रिविमीय ज्यामिति का परिचय (Introduction to three Dimensional Geometry) Ex-12.3
Chapter 13- सीमा और अवकलज (Limits and Derivatives)
Chapter 13- सीमा और अवकलज (Limits and Derivatives) Ex-13.1
Chapter 13- सीमा और अवकलज (Limits and Derivatives) Ex-13.2
Chapter 14- गणितीय विवेचन (Mathematical Reasoning)
Chapter 14- गणितीय विवेचन (Mathematical Reasoning) Ex-14.1
Chapter 14- गणितीय विवेचन (Mathematical Reasoning) Ex-14.2
Chapter 14- गणितीय विवेचन (Mathematical Reasoning) Ex-14.3
Chapter 14- गणितीय विवेचन (Mathematical Reasoning) Ex-14.4
Chapter 14- गणितीय विवेचन (Mathematical Reasoning) Ex-14.5
Chapter 15- सांख्यिकी (Statistics)
Chapter 15- सांख्यिकी (Statistics) Ex-15.1
Chapter 15- सांख्यिकी (Statistics) Ex-15.2
Chapter 15- सांख्यिकी (Statistics) Ex-15.3
Chapter 16- प्रायिकता (Probability)
Chapter 16- प्रायिकता (Probability) Ex-16.1
Chapter 16- प्रायिकता (Probability) Ex-16.2
Chapter 16- प्रायिकता (Probability) Ex-16.3
NCERT Hindi Medium - Class 11 इतिहास (History)
Chapter 1- समय की शुरुआत से (From the Beginning of Time)
Chapter 2- लेखन कला और शहरी जीवन (Writing and City Life)
Chapter 3- तीन महाद्वीपों में फैला हुआ साम्राज्य (An Empire Across Three Continents)
Chapter 4- इस्लाम का उदय और विस्तार-लगभग 570 – 1200 ई० (The Central Islamic Lands)
Chapter 5- यायावर साम्राज्य (Nomadic Empires)
Chapter 6- तीन वर्ग (The Three Orders)
Chapter 7- बदलती हुई सांस्कृतिक परंपराएँ (Changing Cultural Traditions)
Chapter 8- संस्कृतियों का टकराव (Confrontation of Cultures)
Chapter 9- औद्योगिक क्रांति (The Industrial Revolution)
Chapter 10- मूल निवासियों का विस्थापन (Displacing Indigenous Peoples)
Chapter 11- आधुनिकीकरण के रास्ते (Paths to Modernisation)
NCERT Hindi Medium - Class 11 भूगोल (Geography)
Chapter 1- भूगोल एक विषय के रूप में (Geography as a Discipline)
Chapter 2- पृथ्वी की उत्पत्ति एवं विकास (The Origin and Evolution of the Earth)
Chapter 3- पृथ्वी की आंतरिक संरचना (Interior of the Earth)
Chapter 4- महासागरों और महाद्वीपों का वितरण (Distribution of Oceans and Continents)
Chapter 5- खनिज एवं शैल (Minerals and Rocks)
Chapter 6- भू-आकृतिक प्रक्रियाएँ (Geomorphic Processes)
Chapter 7- भू-आकृतियाँ तथा उनका विकास (Landforms and their Evolution)
Chapter 8- वायुमंडल का संघटन तथा संरचना (Composition and Structure of Atmosphere)
Chapter 9- सौर विकिरण, ऊष्मा संतुलन एवं तापमान (Solar Radiation, Heat Balance and Temperature)
Chapter 10- वायुमंडलीय परिसंचरण तथा मौसम प्रणालियाँ (Atmospheric Circulation and Weather Systems)
Chapter 11- वायुमंडल में जल (Water in the Atmosphere)
Chapter 12- विश्व की जलवायु एवं जलवायु परिवर्तन (World Climate and Climate Change)
Chapter 13- महासागरीय जल (Water (Oceans))
Chapter 14- महासागरीय जल संचलन (Movements of Ocean Water)
Chapter 15- पृथ्वी पर जीवन (Life on the Earth)
Chapter 16- जैव विविधता एवं संरक्षण (Biodiversity and Conversation)
NCERT Hindi Medium - Class 11 नागरिकशास्त्र (Civics- Political Science)
Chapter 1- संविधान - क्यों और कैसे (Constitution- Why and How)
Chapter 2- भारतीय संविधान में अधिकार (Rights in the Indian Constitution)
Chapter 3- चुनाव और प्रतिनिधित्व (Election and Representation)
Chapter 4- कार्यपालिका (Executive)
Chapter 5- विधायिका (Legislature)
Chapter 6- न्यायपालिका (Judiciary)
Chapter 7- संघवाद (Federalism)
Chapter 8- स्थानीय शासन (Local Governments)
Chapter 9- संविधान - एक जीवन्त दस्तावेज (Constitution as a Living Document)
Chapter 10- संविधान का राजनीतिक दर्शन (The Philosophy of Constitution)
NCERT Hindi Medium - Class 11 अर्थशास्त्र (Economics)
NCERT Hindi Medium - Class 11 अर्थशास्त्र (Economics)-खण्ड-1 अर्थशास्त्र में सांख्यिकी
Chapter 1- परिचय (Introduction)
Chapter 2- आँकड़ों का संग्रह (Collection of Data)
Chapter 3- आँकड़ों का संगठन (Organisation of Data)
Chapter 4- आँकड़ों का प्रस्तुतीकरण (Presentation of Data)
Chapter 5- केंद्रीय प्रवृत्ति की माप (Measures of Central Tendency)
Chapter 6- परिक्षेपण के माप (Measures of Dispersion)
Chapter 7- सहसंबंध (Correlation)
Chapter 8- सूचकांक (Index Numbers)
Chapter 9- सांख्यिकीय विधियों के उपयोग (Uses of Statistical Methods)
NCERT Hindi Medium - Class 11 अर्थशास्त्र (Economics)-खण्ड -2 भारतीय अर्थव्यवस्था का विकास
Chapter 1- स्वतंत्रता की पूर्व संध्या पर भारतीय अर्थव्यवस्था
Chapter 2- भारतीय अर्थव्यवस्था (1950-1990)
Chapter 3- उदारीकरण-निजीकरण और वैश्वीकरण-एक समीक्षा
Chapter 4- निर्धनता
Chapter 5- भारत में मानव पूँजी का निर्माण
Chapter 6- ग्रामीण विकास
Chapter 7- रोजगार-संवृद्धि-अनौपचारीकरण एवं अन्य मुद्दे
Chapter 8- संरचना
Chapter 9- पर्यावरण और धारणीय विकास
Chapter 10- भारत और इसके पड़ोसी देशों के तुलनात्मक विकास अनुभव
NCERT Hindi Medium - Class 11 हिन्दी ( Hindi)
NCERT Hindi Medium - Class 11 English
NCERT Hindi Medium - Class 12
NCERT Hindi Medium - Class 12 भौतिक विज्ञान (Physics)
Chapter 1- वैद्युत आवेश तथा क्षेत्र (Electric Charges and Fields)
Chapter 2- स्थिरवैद्युत विभव तथा धारिता (Electrostatic Potential and Capacitance)
Chapter 3- विद्युत धारा (Current Electricity)
Chapter 4- गतिमान आवेश और चुम्बकत्व (Moving Charges and Magnetism)
Chapter 5- चुम्बकत्व एवं द्रव्य (Magnetism and Matter)
Chapter 6- वैद्युत चुम्बकीय प्रेरण (Electromagnetic Induction)
Chapter 7- प्रत्यावर्ती धारा (Alternating Current)
Chapter 8- वैद्युत चुम्बकीय तरंगें (Electromagnetic Waves)
Chapter 9- किरण प्रकाशिकी एवं प्रकाशिक यंत्र (Ray Optics and Optical Instruments)
Chapter 10- तरंग-प्रकाशिकी (Wave Optics)
Chapter 11- विकिरण तथा द्रव्य की द्वैत प्रकृति (Dual Nature of Radiation and Matter)
Chapter 12- परमाणु (Atoms)
Chapter 13- नाभिक (Nuclei)
Chapter 14- अर्द्धचालक इलेक्ट्रॉनिकी
Chapter 15- संचार व्यवस्था (Communication Systems)
NCERT Hindi Medium - Class 12 रसायन विज्ञान (Chemistry)
Chapter 1- ठोस अवस्था (The Solid State)
Chapter 2- विलयन (Solutions)
Chapter 3- वैद्युत रसायन (Electro Chemistry)
Chapter 4- रासायनिक बलगतिकी (Chemical Kinetics)
Chapter 5- पृष्ठ रसायन (Surface Chemistry)
Chapter 6- तत्त्वों के निष्कर्षण के सिद्धान्त एवं प्रक्रम (General Principles and Processes of Isola
Chapter 7- p-ब्लॉक के तत्त्व (The p Block Elements)
Chapter 8- d-एवं f-ब्लॉक के तत्त्व (The d and f Block Elements)
Chapter 9- उपसहसंयोजन यौगिक (Coordination Compounds)
Chapter 10- हैलोऐल्केन तथा हैलोऐरीन (Haloalkanes and Haloarenes)
Chapter 11- ऐल्कोहॉल, फीनॉल एवं ईथर (Alcohols Phenols and Ethers)
Chapter 12- ऐल्डिहाइड कीटोन एवं कार्बोक्सिलिक अम्ल (Aldehydes Ketones and Carboxylic Acids)
Chapter 13- ऐमीन (Amines)
Chapter 14- जैव-अणु (Biomolecules)
Chapter 15- बहुलक (Polymers)
Chapter 16- दैनिक जीवन में रसायन (Chemistry in Everyday Life)
NCERT Hindi Medium - Class 12 जीव विज्ञान (Biology)
Chapter 1- जीवों में जनन (Reproduction in Organisms)
Chapter 2- पुष्पी पादपों में लैंगिक प्रजनन (Sexual Reproduction in Flowering Plants)
Chapter 3- मानव जनन (Human Reproduction)
Chapter 4- जनन स्वास्थ्य (Reproductive Health)
Chapter 5- वंशागति और विविधता के सिद्धान्त (Principles of Inheritance and Variation)
Chapter 6- वंशागति का आणविक आधार (Molecular Basis of Inheritance)
Chapter 7- विकास (Evolution)
Chapter 8- मानव स्वास्थ्य तथा रोग (Human Health and Disease)
Chapter 9- खाद्य उत्पादन में वृद्धि की कार्यनीति (Strategies for Enhancement in Food Production)
Chapter 10- मानव कल्याण में सूक्ष्मजीव (Microbes in Human Welfare)
Chapter 11- जैव प्रौद्योगिकी-सिद्धान्त व प्रक्रम (Biotechnology- Principles and Processes)
Chapter 12- जैव प्रौद्योगिकी एवं उसके उपयोग (Biotechnology and its Applications)
Chapter 13- जीव और समष्टियाँ (Organisms and Populations)
Chapter 14- पारितन्त्र (Ecosystem)
Chapter 15- जैव विविधता एवं संरक्षण (Biodiversity and Conservation)
Chapter 16- पर्यावरण के मुद्दे (Environmental Issues)
NCERT Hindi Medium - Class 12 गणित (Maths)
Chapter 1- सम्बन्ध एवं फलन (Relations and Functions)
Chapter 1- सम्बन्ध एवं फलन (Relations and Functions) Ex-1.1
Chapter 1- सम्बन्ध एवं फलन (Relations and Functions) Ex-1.2
Chapter 1- सम्बन्ध एवं फलन (Relations and Functions) Ex-1.3
Chapter 1- सम्बन्ध एवं फलन (Relations and Functions) Ex-1.4
Chapter 2- प्रतिलोम त्रिकोणमितीय फलन (Inverse Trigonometric Functions)
Chapter 2- प्रतिलोम त्रिकोणमितीय फलन (Inverse Trigonometric Functions) Ex-2.1
Chapter 2- प्रतिलोम त्रिकोणमितीय फलन (Inverse Trigonometric Functions) Ex-2.2
Chapter 3- आव्यूह (Matrices)
Chapter 3- आव्यूह (Matrices) Ex-3.1
Chapter 3- आव्यूह (Matrices) Ex-3.2
Chapter 3- आव्यूह (Matrices) Ex-3.3
Chapter 3- आव्यूह (Matrices) Ex-3.4
Chapter 4- सारणिक (Determinants)
Chapter 4- सारणिक (Determinants) Ex-4.1
Chapter 4- सारणिक (Determinants) Ex-4.2
Chapter 4- सारणिक (Determinants) Ex-4.3
Chapter 4- सारणिक (Determinants) Ex-4.4
Chapter 4- सारणिक (Determinants) Ex-4.5
Chapter 4- सारणिक (Determinants) Ex-4.6
Chapter 5- सांतत्य तथा अवकलनीयता (Continuity and Differentiability)
Chapter 5- सांतत्य तथा अवकलनीयता (Continuity and Differentiability) Ex-5.1
Chapter 5- सांतत्य तथा अवकलनीयता (Continuity and Differentiability) Ex-5.2
Chapter 5- सांतत्य तथा अवकलनीयता (Continuity and Differentiability) Ex-5.3
Chapter 5- सांतत्य तथा अवकलनीयता (Continuity and Differentiability) Ex-5.4
Chapter 5- सांतत्य तथा अवकलनीयता (Continuity and Differentiability) Ex-5.5
Chapter 5- सांतत्य तथा अवकलनीयता (Continuity and Differentiability) Ex-5.6
Chapter 5- सांतत्य तथा अवकलनीयता (Continuity and Differentiability) Ex-5.7
Chapter 5- सांतत्य तथा अवकलनीयता (Continuity and Differentiability) Ex-5.8
Chapter 6- अवकलज के अनुप्रयोग (Application of Derivatives)
Chapter 6- अवकलज के अनुप्रयोग (Application of Derivatives) Ex-6.1
Chapter 6- अवकलज के अनुप्रयोग (Application of Derivatives) Ex-6.2
Chapter 6- अवकलज के अनुप्रयोग (Application of Derivatives) Ex-6.3
Chapter 6- अवकलज के अनुप्रयोग (Application of Derivatives) Ex-6.4
Chapter 6- अवकलज के अनुप्रयोग (Application of Derivatives) Ex-6.5
Chapter 7- समाकलन (Integrals)
Chapter 7- समाकलन (Integrals) Ex-7.1
Chapter 7- समाकलन (Integrals) Ex-7.2
Chapter 7- समाकलन (Integrals) Ex-7.3
Chapter 7- समाकलन (Integrals) Ex-7.4
Chapter 7- समाकलन (Integrals) Ex-7.5
Chapter 7- समाकलन (Integrals) Ex-7.6
Chapter 7- समाकलन (Integrals) Ex-7.7
Chapter 7- समाकलन (Integrals) Ex-7.8
Chapter 7- समाकलन (Integrals) Ex-7.9
Chapter 7- समाकलन (Integrals) Ex-7.10
Chapter 7- समाकलन (Integrals) Ex-7.11
Chapter 8- समाकलनों के अनुप्रयोग (Application of Integrals)
Chapter 8- समाकलनों के अनुप्रयोग (Application of Integrals) Ex-8.1
Chapter 8- समाकलनों के अनुप्रयोग (Application of Integrals) Ex-8.2
Chapter 9- अवकल समीकरण (Differential Equations)
Chapter 9- अवकल समीकरण (Differential Equations) Ex-9.1
Chapter 9- अवकल समीकरण (Differential Equations) Ex-9.2
Chapter 9- अवकल समीकरण (Differential Equations) Ex-9.3
Chapter 9- अवकल समीकरण (Differential Equations) Ex-9.4
Chapter 9- अवकल समीकरण (Differential Equations) Ex-9.5
Chapter 9- अवकल समीकरण (Differential Equations) Ex-9.6
Chapter 10- सदिश बीजगणित (Vector Algebra)
Chapter 10- सदिश बीजगणित (Vector Algebra) Ex-10.1
Chapter 10- सदिश बीजगणित (Vector Algebra) Ex-10.2
Chapter 10- सदिश बीजगणित (Vector Algebra) Ex-10.3
Chapter 10- सदिश बीजगणित (Vector Algebra) Ex-10.4
Chapter 11- त्रिविमीय ज्यामिति (Three Dimensional Geometry)
Chapter 11- त्रिविमीय ज्यामिति (Three Dimensional Geometry) Ex-11.1
Chapter 11- त्रिविमीय ज्यामिति (Three Dimensional Geometry) Ex-11.2
Chapter 11- त्रिविमीय ज्यामिति (Three Dimensional Geometry) Ex-11.3
Chapter 12- रैखिक प्रोग्रामन (Linear Programming)
Chapter 12- रैखिक प्रोग्रामन (Linear Programming) Ex-12.1
Chapter 12- रैखिक प्रोग्रामन (Linear Programming) Ex-12.2
Chapter 13- प्रायिकता (Probability)
Chapter 13- प्रायिकता (Probability) Ex-13.1
Chapter 13- प्रायिकता (Probability) Ex-13.2
Chapter 13- प्रायिकता (Probability) Ex-13.3
Chapter 13- प्रायिकता (Probability) Ex-13.4
Chapter 13- प्रायिकता (Probability) Ex-13.5
NCERT Hindi Medium - Class 12 Geography भूगोल खण्ड 1-मानव भूगोल के मूल सिद्धांत
Chapter 1- मानव भूगोल – प्रकृति एवं विषय क्षेत्र (Human Geography)
Chapter 2- विश्व जनसंख्या-वितरण- घनत्व और वृद्धि (The World Population)
Chapter 3- जनसंख्या संघटन (Population Composition)
Chapter 4- मानव विकास (Human Development)
Chapter 5- प्राथमिक क्रियाएँ (Primary Activities)
Chapter 6- द्वितीयक क्रियाएँ (Secondary Activities)
Chapter 7- तृतीयक और चतुर्थ क्रियाकलाप (Tertiary and Quaternary Activities)
Chapter 8- परिवहन एवं संचार (Transport and Communication)
Chapter 9- अंतर्राष्ट्रीय व्यापार (International Trade)
Chapter 10- मानव बस्ती (Human Settlements)
NCERT Hindi Medium - Class 12 Geography भूगोल खण्ड 2-भारत – लोग और अर्थव्यवस्था
Chapter 1- जनसंख्या- वितरण- घनत्व- वृद्धि एवं संघटन
Chapter 2- प्रवास-प्रकार- कारण और परिणाम
Chapter 3- मानव विकास
Chapter 4- मानव बस्तियाँ
Chapter 5- भूसंसाधन तथा कृषि
Chapter 6- जल – संसाधन
Chapter 7- खनिज तथा ऊर्जा संसाधन
Chapter 8- निर्माण उद्योग
Chapter 9- भारत के संदर्भ में नियोजन और सततपोषणीय विकास
Chapter 10- परिवहन तथा संचार
Chapter 11- अंतर्राष्ट्रीय व्यापार
Chapter 12- भौगोलिक परिप्रेक्ष्य में चयनित कुछ मुद्दे एवं समस्याएँ
NCERT Hindi Medium - Class 12 English
NCERT Hindi Medium - Class 12 हिन्दी ( Hindi)
Question -
If the sequence of one strand of DNA is written as follows:
Answer -
5'-ATGCATGCATGCATGCATGCATGCATGC-3'
Write down the sequence of complementary strand in 5'→3' direction
Answer
The DNA strands are complementary to each other with respect to base sequence. Hence, if the sequence of one strand of DNA is
5'- ATGCATGCATGCATGCATGCATGCATGC − 3’
Then, the sequence of complementary strand in direction will be
3'- TACGTACGTACGTACGTACGTACGTACG − 5’
Therefore, the sequence of nucleotides on DNA polypeptide in direction is
5'- GCATGCATGCATGCATGCATGCATGCAT− 3’
Comment(S)
Show all Coment
Leave a Comment
Free - Previous Years Question Papers
Any questions? Ask us!
NodeJS Interview Questions Answers
ASP.Net Interview Questions Answers
Interview Questions Answers
×
Subscribe Now!